Busch Lab

ZMP

gpt2

Ensembl ID:
ENSDARG00000012199
ZFIN ID:
ZDB-GENE-030729-8
Description:
alanine aminotransferase 2 [Source:RefSeq peptide;Acc:NP_001092227]
Human Orthologue:
GPT2
Human Description:
glutamic pyruvate transaminase (alanine aminotransferase) 2 [Source:HGNC Symbol;Acc:18062]
Mouse Orthologue:
Gpt2
Mouse Description:
glutamic pyruvate transaminase (alanine aminotransferase) 2 Gene [Source:MGI Symbol;Acc:MGI:1915391]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa9039 Nonsense Mutation detected in F1 DNA Not yet available
sa383 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9039
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115090 Nonsense 98 545 1 11
Genomic Location (Zv9):
Chromosome 7 (position 44617530)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41607830
GRCz11 7 41887903
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGCCGTGAGAGGACCCATCGTTATCAAAGCTGGAGAGATTGAGAGATGCT[T/A]GGAGGAGGTGAGGACATGTTTCGGAGATTTGTTTTCTTTAAAGAGGCAGT
Associated Phenotype:
Not determined