Busch Lab

ZMP

CNGA1 (1 of 2)

Ensembl ID:
ENSDARG00000012125
Description:
cyclic nucleotide gated channel alpha 1 [Source:HGNC Symbol;Acc:2148]
Human Orthologue:
CNGA1
Human Description:
cyclic nucleotide gated channel alpha 1 [Source:HGNC Symbol;Acc:2148]
Mouse Orthologue:
Cnga1
Mouse Description:
cyclic nucleotide gated channel alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88436]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa24412 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24412
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017375 Nonsense 319 611 8 9
Genomic Location (Zv9):
Chromosome 23 (position 44031333)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44061500
GRCz11 23 43863018
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGCTCACTACCATCGGCGAAACACCGCCGCCCGTCGAAAACTCTGAGTA[C/A]TTCTTCGTAGTCACCGACTTTCTAGTCGGCGTGTTGATTTTCGCAACAAT
Long Flanking Sequence:
ACTTGTCTTGAACCCTTGTTTGTTTGTTATTTATCCTCAGGATATCTGGAGCAGGGTCTTCTAGTGAAAGATCAGAAAAAGCTTCGCGATCGCTACACAGACAGCTTGCAGTTTAGACTGGATCTAGCCTCAATGGTTCCCACAGATATTTTCTACCTGTACTTCGGCATGAACTACCCAGAGATTCGCATGAACAAGCTCCTGAGGATCAATCGACTGTTTGAGTTTTTCCAGCGCACCGAAACGCGGACTAACTTTCCCAACGTCTTCCGAATCTCCAACCTCGTCATGTACATCGTGATCATCATCCACTGGAACGCCTGCATGTATTACTCTTTCTCCAAAGCCATCGGTTTTGGATCAGACGCTTTCGTGTACCCGGACCCTTCAGATCCTGAGTTTGGCCGATTGGTACGTAAATATGCCTACAGCATGTACTGGTCCACCCTGACGCTCACTACCATCGGCGAAACACCGCCGCCCGTCGAAAACTCTGAGTA[C/A]TTCTTCGTAGTCACCGACTTTCTAGTCGGCGTGTTGATTTTCGCAACAATCGTCGGTAACGTCGGCTCAATGATCACAAATGCCAACGCAGCACGAGCCGATTTCCAAGCTCGCATCGATGCTATTAAACAATACATGAGCTTTCGGAAAGTCACCAAGGATTTGGAGAAACGGGTTATTAAATGGTTTGATTATTTGTGGACCAATAAAAAGGCGGTCGATGAGAGAGAAGTACTGAAGTATCTTCCCGACAAGCTGAGGGCGGAGATAGCCATAAACGTCCATCTGGATACGCTAAAAAAAGTGCGTATCTTTGCGGACTGTGAAGCCGGGCTTTTGGTGGAGCTGGTGTTAAAGCTGCAGCCGCAGGTTTACAGCCCTGGAGACTATATATGCAAAAAGGGCGACATCGGGCGCGAGATGTACATCATTAAAGAGGGTAAACTGGCTGTGGTGGCGGATGACGGGATTACGCAGTTCGTGGTGCTCAGTGATGGGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3240
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017375 Nonsense 592 611 9 9
Genomic Location (Zv9):
Chromosome 23 (position 44034269)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44064436
GRCz11 23 43865954
KASP Assay ID:
554-3427.1 (used for ordering genotyping assays)
KASP Sequence:
GCGGTGTGCTGGAGGACCTGCAGACACGCTTCGCCCGTCTTTTAGCTGAA[C/T]AAGAAGCTGCTCAGGGAAAACTGAAGAAGCGCGTCACTAAGCTGGAGAAG
Long Flanking Sequence:
AGGAAACTTCATTTTCAAAAATGGCTGGTGAATATTTGCCCAAAAGGGACTTTAAAACAAATAAATTGTGAGTAAATGGTGACAGAATTTTTATTCTTGGGTGAACTATCACTATTTTAGGGTTAGTTTACCCCAAACATTCTGTTATTAATCACTTAATATTGTTCCAAACCTCTGACAACCCCTAAAAAAATTTAGATTAAATCTGAGAGTTCTCTCATCCACCATAGACAACAAGAGTCAATTTGAGTGTGAGTAAATTTACATTTTTGGGTGAACCCGAACCGTCCCTTTAATGATAGTTAGTTATTAAAGAGCAACAGACTTTCTGGGTAGCTTGATGTAACTGTGAGTTTTATTATTTTCCTCCACAGGATAATCTCCTGGATTTGGAGTTGGCCAAGCAGGGTCCCGATCCCAAAGACATGGAGGAGAAGGTGCAGAAGATCGGCGGTGTGCTGGAGGACCTGCAGACACGCTTCGCCCGTCTTTTAGCTGAA[C/T]AAGAAGCTGCTCAGGGAAAACTGAAGAAGCGCGTCACTAAGCTGGAGAAGAAGATGACCAGCGAAACTCTGATGGAGCCACCGCCGGAAACTGCAGACAAGACTGACTAGACTGAGCCCATGAAACCCATTAGTTTTCCCACACTACAATAATACTACAGTCATTTACAGTAAATACTATAGTGTTTTTTAATCATACTATAGTAGAGTGGATTATACTGTATATATCACAGGATCTACAACTCGTTAATGTTCAGGAATGCTGCAGCGGATAAACTGTAAAAAAACACAGTACTATACTTCAGGTTTTACTACAGTAAACTGTGGTGTATTGTATATTATACACTATAGTTGTAGAAAAGTACAGCACTGGGTCATTTGTTTATATTACTATAGTTGTTGCGTTACCAGAGCAACTATAAAATCACTGCACCAGATTAATTTTATTAATATAGTTGTGTTACCATAGCAACTGTAAAATCACTACAACAGATTAATTTT
Associated Phenotype:
Not determined