Busch Lab

ZMP

LOC557995

Ensembl ID:
ENSDARG00000012040
Human Orthologue:
RNF19A
Human Description:
ring finger protein 19A [Source:HGNC Symbol;Acc:13432]
Mouse Orthologues:
1700001J11Rik, Rnf19a
Mouse Descriptions:
RIKEN cDNA 1700001J11 gene Pseudogene [Source:MGI Symbol;Acc:MGI:1919474]
ring finger protein 19A Gene [Source:MGI Symbol;Acc:MGI:1353623]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa23479 Essential Splice Site Available for shipment Available now
sa14753 Nonsense Available for shipment Available now
sa23478 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23479
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024193 Essential Splice Site 464 913 5 10
Genomic Location (Zv9):
Chromosome 19 (position 12669000)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12127346
GRCz11 19 12046874
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCCATACCCGCGATGATCATTGGGATACCGGTGTATGTGGGAAGAAAG[G/T]TGGGTGGTCGTCTTTAAATGTTAAAAATGAAGGGTGAGGTGTACATGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14753
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024193 Nonsense 887 913 10 10
Genomic Location (Zv9):
Chromosome 19 (position 12655409)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12113755
GRCz11 19 12033283
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTACATTGCAGAGGAGAATGTGAGTTTAATGTGTGCGGCTAATGCGAGC[C/T]AGAGCTCGCCTAAAGAACGCAATAACAAYCTTCCTCAGCCAGCTAGCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23478
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024193 Nonsense 912 913 10 10
Genomic Location (Zv9):
Chromosome 19 (position 12655334)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12113680
GRCz11 19 12033208
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAACCTTCCTCAGCCAGCTAGCCCTGTGCGCAACACCTGCATTCAAACC[G/T]AGATATAACCAGACGGGTCGACTTCACCCAAAATGCTTTCACAGCTAACC
Associated Phenotype:
Not determined