Busch Lab

ZMP

cpa6

Ensembl ID:
ENSDARG00000012013
ZFIN ID:
ZDB-GENE-091204-331
Human Orthologue:
CPA6
Human Description:
carboxypeptidase A6 [Source:HGNC Symbol;Acc:17245]
Mouse Orthologue:
Cpa6
Mouse Description:
carboxypeptidase A6 Gene [Source:MGI Symbol;Acc:MGI:3045348]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa30080 Nonsense Mutation detected in F1 DNA Not yet available
sa1089 Nonsense F2 line generated Not yet available
sa37863 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa30080
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106188 Nonsense 108 442 3 11
ENSDART00000134518 None None 69 None 3
ENSDART00000144244 Nonsense 108 175 3 5
ENSDART00000147748 Nonsense 108 217 3 6
Genomic Location (Zv9):
Chromosome 24 (position 19453863)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18760017
GRCz11 24 18904436
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACAAGACGCATTGGCTGAGAAATCATCTTCACCAAGAACACATCTACTA[C/A]GAGTGAGTCTCTTTTTCCACTGTTATAAGACTCCTGTGGGATAAATATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1089
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106188 Nonsense 139 442 4 11
ENSDART00000134518 None None 69 None 3
ENSDART00000144244 Nonsense 139 175 4 5
ENSDART00000147748 Nonsense 139 217 4 6
ENSDART00000106188 Nonsense 139 442 4 11
ENSDART00000134518 None None 69 None 3
ENSDART00000144244 Nonsense 139 175 4 5
ENSDART00000147748 Nonsense 139 217 4 6
Genomic Location (Zv9):
Chromosome 24 (position 19447397)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18753551
GRCz11 24 18897970
KASP Assay ID:
554-0991.1 (used for ordering genotyping assays)
KASP Sequence:
ACGGGGTACCGGTCCTCTAGGAAGCGCAGATCTGAACTTCAGTATGACTA[T/G]GAAGTGTACCATCCTTTAGAAGAGGTGAGCAMATGGCTGACAAGTAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37863
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106188 Nonsense 139 442 4 11
ENSDART00000134518 None None 69 None 3
ENSDART00000144244 Nonsense 139 175 4 5
ENSDART00000147748 Nonsense 139 217 4 6
ENSDART00000106188 Nonsense 139 442 4 11
ENSDART00000134518 None None 69 None 3
ENSDART00000144244 Nonsense 139 175 4 5
ENSDART00000147748 Nonsense 139 217 4 6
Genomic Location (Zv9):
Chromosome 24 (position 19447397)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18753551
GRCz11 24 18897970
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGGGGTACCGGTCCTCTAGGAAGCGCAGATCTGAACTTCAGTATGACTA[T/A]GAAGTGTACCATCCTTTAGAAGAGGTGAGCACATGGCTGACAAGTAACAA
Associated Phenotype:
Not determined