Busch Lab

ZMP

zgc:136908

Ensembl ID:
ENSDARG00000011983
ZFIN ID:
ZDB-GENE-060312-22
Description:
hypothetical protein LOC563679 [Source:RefSeq peptide;Acc:NP_001035017]
Human Orthologue:
VCP
Human Description:
valosin-containing protein [Source:HGNC Symbol;Acc:12666]
Mouse Orthologue:
Vcp
Mouse Description:
valosin containing protein Gene [Source:MGI Symbol;Acc:MGI:99919]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa32789 Nonsense Mutation detected in F1 DNA Not yet available
sa19620 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32789
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100551 Nonsense 107 805 4 19
Genomic Location (Zv9):
Chromosome 1 (position 56341129)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55123675
GRCz11 1 55801326
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCTCAGTGAGTAACGCATCTGTCTGTGTGTATACAGTATCCATCCTTG[T/A]CCAGATGTGAAATATGGGAAGCGCATCCACGTTCTGCCCATTGATGACAC
Long Flanking Sequence:
GTATAGTGGCGTATATTTGGTGATGATAGATTCACTGTACTTTGTTGTATGTTGGATTTAACTTGTAAAATGTTTAAAAAAGGTGACCTATTATGCAAAAATCACTTTTATAAGGTGTTTAAACACAGTTGTATGGCAGCAGTGTGTGCATATAAACTGCCTCTAATGGTAAAAATTAATTAATTGTATTATTTGTAATTAGACTTGATAAAGCAGTCTGCAGGAACTCTTTGATTGACATTCTCCCTTTGTACGTGTCATCAGATGGGGAAAGCCCCGCCCACTAGTGACCATCTCTCCCTCATTAGCATAAACAGCCCTGAGTGAGAAGCAGCGGTGAGCCAATAGAGTGTTTGAGCTGCTGAAGATAATGCCAGCATAGACGAAGAGGATTATAAATGTGGAGTTTCAGATGACGCACAAATGATCACATAAATATTACATCTGCTTCTTCTCAGTGAGTAACGCATCTGTCTGTGTGTATACAGTATCCATCCTTG[T/A]CCAGATGTGAAATATGGGAAGCGCATCCACGTTCTGCCCATTGATGACACTATCGAAGGGCTGACGGGAAACCTGTTTGACGTATTTCTGAAGCCGTATTTCCTGGAGGCTTACAGACCGGTTCACAAAGGTGCATATGATCATTCGGTGTGTGTCAGAGATTAGAGGCAGGTCTTCCTTCAGGGACTGCTTTGATATTGAGTGTGGTTTTGTGATTTGGGTCTACTTTGAAGTTCAGATTGACATTGAGACCGCCGGGGTTGGAATAACAAATAGGTTAAGTTATAAATTTGAAGTCATGTGTTTTTACAAGCTTATTAATGATGTAGTTTTTGGTTGCCACCAATAATCGACTAAATATTAATAGTAATAATCATATTAAGCTGCCAAATACAATACAGTGTTGAAACTGTAGTTCTTGTTAAATATTTCCTTTATTTATATACACACTACCTGACAAAAGTCTTGTCGCCTATCCAAGTTTTAGAAACAACAAATAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7920
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100551 Nonsense 321 805 9 19
Genomic Location (Zv9):
Chromosome 1 (position 56335697)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55118243
GRCz11 1 55795894
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGATGTTTGGCAYTCRATTAATGCTCATGTCACCTCTTTAGACKCACGGT[G/T]AGGTTGAGCGGAGGATCGTCTCTCAGTTGCTCACGCTGATGGACGGCCTG
Long Flanking Sequence:
TCAAACAGTCAGTCAACAGCGGCCTCTGGTGGGTTTGCATGAGAACAGCAGGCACGAACGGCACTCACGAAAGAAATTTGACATGAAAAGGCATACACAGCGGCCTCTTGTGAATTCGCGAAACAAAACTGCCAAATTACGTACCTCCTCGGATGCATTTCGTGGTTTCCAGAAACGTACCATTAATGTATATCTATATTATTTGGCCAAATATCATATCAGTAACACTCCTGCTGTGTATTTCTACACCTTCATGTTGTTATTTTTGTATCCCAGGTCCTGAAATCATGAGTAAGCTGGCAGGAGAGTCTGAGAGCAACCTGAGAAAAGCTTTCGAGGAGGCTGAAAAAAACGCCCCTGCTATCATCTTCATCGATGAGCTGGATGCTATCGCTCCGAAACGTGAGAAGGTGAGGAGAGATACTCTATGTGCTGTGAGAGTGTCCGGTCTGATGTTTGGCATTCAATTAATGCTCATGTCACCTCTTTAGACTCACGGT[G/T]AGGTTGAGCGGAGGATCGTCTCTCAGTTGCTCACGCTGATGGACGGCCTGAAACAGCGCGCTCATGTTGTCGTAATGGCAGCTACAAACAGGCCCAACAGTGTGGATGCTGCTCTTCGGCGATTTGGTGTGAATATGCACATTTAACAGTCTTTATTGCTAATGCTATTTTGTAGAGTTTGATTTTTTTGAGAAATTGATTCTGCATCGATTCTGAGATGTCCACATCACTGCAATGCTCACTTGAATTGATTTTGACCTTTATTTACAACTGTAGATGGCGCTCTAGGGTAGTTTATAATAGCAGATTGTGTTCTAAGCTGGTTTTGAAAAGCAGATGGCATTTTAGGCAGATTTGAATAGCAGACGGTGCTCTAGGTTAATTTTTAACAGCAGGTGGTGCTCTAGGCTTGTTTTTAACACAAGGTGGTGCTCTGGGCTAGTTCATAACAACAAATGGCGCTCTAGGTTTTTTTTTGAACAGCAGATAGGTGGCCCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19620
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100551 Nonsense 787 805 19 19
Genomic Location (Zv9):
Chromosome 1 (position 56327104)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55109650
GRCz11 1 55787301
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTCGTCGTCAGGTTTCCTACTGCGCCCAAGTCAGGAGGAGGTCAAGGGT[C/A]GAGCCAAGGCTCTGGAGGTCATTTCAGAGATGAAGGAGACGATGATCTCT
Long Flanking Sequence:
AATCACAATTCCCCCCGCCATGTCAGGAAAAAATACACACTCTAAATATGTTTGTCCATTGCCTAGTAGGCCGATCCATTAATTCGCTTACAGAAATATCTTTTAACATTCGGGTTATTAAACATAGCATCTAATATAAAGCTCTCTTTCTTTAATGTTGTGACATGCATTTAGGGGTCTTCATACCTACAGGGTGTTATATCTTCACTGCTGTTTCCAGGATGATGATTACGACCCAGTGCCTGAGATCAGGAAGGATCATTTCGAGGAAGCCATGAGATTTGCTCGTCGGTCTGTCAGTGATAATGACATAAGGAAGTATGAGATGTTTGCTCAGACTCTTCAACAGAGCCGTGGATTTGGGAACTTCAGGTACTAAAACACCAAATCAAAGGTAGCTTATTTTACTCCACACCTCATCTTGTAAAGTAAATTGTTTCTTTTTCTTTAACTCGTCGTCAGGTTTCCTACTGCGCCCAAGTCAGGAGGAGGTCAAGGGT[C/A]GAGCCAAGGCTCTGGAGGTCATTTCAGAGATGAAGGAGACGATGATCTCTATCAGTAATCAACAGTCCTCCATGGCACCGGTTGTCTGCAACAGTGAAAGAAGAATGAAATCAGTTTGCTAATGAATTTGCTCATTATCAATATTATGTATGCTATTTTCAATTCTGACAGGGATTTTAATATCTTAGTACTGCAGGAAACTAATGGCACACGTATTAAACTGAATGCCTAGTACTTCAATAAAATGATGAGATGATATTGTTAATCACATTTGTTTGTGTGAATGTGTGTGACATTAATAAAGTCCCTAGGTGATTTTGCTGTCATCCATCTTCTCCCAAATGCCATCATAAAGGTCATAACATTTTAAAAGCAAGATTGTAAACACTGCTTACTACGTAAAATAAATAACAGAAATATTGCAAAACAGGACAAATTTGAAGGTAGACATCCATTCAATCGTTTTAGTAAAAAAAATATATATATATTCCATTGTTTCT
Associated Phenotype:
Not determined