Busch Lab

ZMP

fmn1

Ensembl ID:
ENSDARG00000011975
ZFIN ID:
ZDB-GENE-041001-198
Description:
Novel protein similar to vertebrate formin (Limb deformity) (FMN) [Source:UniProtKB/TrEMBL;Acc:Q5RIQ
Human Orthologue:
FMN1
Human Description:
formin 1 [Source:HGNC Symbol;Acc:3768]
Mouse Orthologue:
Fmn1
Mouse Description:
formin 1 Gene [Source:MGI Symbol;Acc:MGI:101815]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa11299 Nonsense Available for shipment Available now
sa43462 Nonsense Mutation detected in F1 DNA Not yet available
sa39286 Nonsense Mutation detected in F1 DNA Not yet available
sa1135 Nonsense F2 line generated Not yet available
sa29378 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa11299
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019819 Nonsense 40 1303 1 13
ENSDART00000136804 None None 443 None 13
Genomic Location (Zv9):
Chromosome 20 (position 29462790)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29534003
GRCz11 20 29436882
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATCACTGTCTGAGGAAAATACAAATATKATTAATTTTCACTCTTTGACT[G/T]GAAAAGGAGATGTTCATGGTCAACAAACATGTATTCAAAGGCAGGATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43462
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019819 Nonsense 568 1303 1 13
ENSDART00000136804 None None 443 None 13
Genomic Location (Zv9):
Chromosome 20 (position 29464374)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29535587
GRCz11 20 29438466
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTAAAGGCTTTCTTTACAGTTAAATCTGCCAAGAAGGACTCTTCTAAT[C/T]GAAAGGACCTGGATATTGTGAAGAAGAAGATCAACAGGGACAAAGAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39286
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019819 Nonsense 690 1303 4 13
ENSDART00000136804 None None 443 None 13
Genomic Location (Zv9):
Chromosome 20 (position 29468292)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29539505
GRCz11 20 29442384
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGAAGAATGAGCAGAATTTGTCCAGACTCAGCGCAACCATTGCAAGCT[T/A]ACAAAGAGAGAGAGACAAAGTTCACCACAGAGAACACCAACATGTTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1135
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019819 Nonsense 985 1303 5 13
ENSDART00000136804 Nonsense 69 443 2 13
Genomic Location (Zv9):
Chromosome 20 (position 29471625)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29542838
GRCz11 20 29445717
KASP Assay ID:
554-1046.1 (used for ordering genotyping assays)
KASP Sequence:
TTTGCTAAAGCCACATCGCCCACCAAAAGAAAGCCCCTATCTGATGCCTA[T/A]GAGAAGAAAACCAAAGCCAGGAAGGTAGCACKCTTTCCTCAAGATCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29378
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019819 Nonsense 1300 1303 13 13
ENSDART00000136804 None None 443 None 13
Genomic Location (Zv9):
Chromosome 20 (position 29489848)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29561061
GRCz11 20 29463940
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTATTTATGGGCTCTGTCACATCGGCCAATCCCTCACGTCTACCCTGTTC[A/T]GATATGAAGTTTAGTTGGTCTCTGAGACAATCCGTCTCTCTAGATGATTG
Associated Phenotype:
Not determined