Busch Lab

ZMP

si:dkey-114g7.2

Ensembl ID:
ENSDARG00000011955
ZFIN ID:
ZDB-GENE-060503-803
Description:
Novel protein similar to vertebrate chaperone, ABC1 activity of bc1 complex like (S. pombe) (CABC1)
Human Orthologue:
ADCK4
Human Description:
aarF domain containing kinase 4 [Source:HGNC Symbol;Acc:19041]
Mouse Orthologue:
Adck4
Mouse Description:
aarF domain containing kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1924139]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa35821 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24977 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32019 Nonsense Available for shipment Available now
sa6367 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35821
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006829 Essential Splice Site 1 624 None 15
ENSDART00000140621 Essential Splice Site 1 623 None 15
ENSDART00000006829 Essential Splice Site 1 624 None 15
ENSDART00000140621 Essential Splice Site 1 623 None 15
Genomic Location (Zv9):
Chromosome 15 (position 13608057)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14653654
GRCz11 15 14589611
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGGACACTTCATAGAGACGCTGAGGAGACTCTAAACTCTCAATACGAG[T/A]AAGTAACGATAACATTACTGGTAGGAAACTACACTGCTGTGATAATTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24977
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006829 Essential Splice Site 1 624 None 15
ENSDART00000140621 Essential Splice Site 1 623 None 15
ENSDART00000006829 Essential Splice Site 1 624 None 15
ENSDART00000140621 Essential Splice Site 1 623 None 15
Genomic Location (Zv9):
Chromosome 15 (position 13608057)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14653654
GRCz11 15 14589611
KASP Assay ID:
554-7318.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGGACACTTCATAGAGACGCTGAGGAGACTCTAAACTCTCAATACGAG[T/A]AAGTAACGATAACATTACTGGTAGGAAACTACACTGCTGTGATAATTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32019
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006829 Nonsense 85 624 3 15
ENSDART00000140621 Nonsense 85 623 3 15
Genomic Location (Zv9):
Chromosome 15 (position 13626520)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14635191
GRCz11 15 14571148
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGGAATTGAGAAGTGGGAGGAGATGGACCTGGATGAAGCTGCAAAGTG[G/A]TCGGTCGCCTCAGAAATGCCACCAGACTTTTCCAGTAAAGACGGAAGGGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28412
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006829 Essential Splice Site 171 624 3 15
ENSDART00000140621 Essential Splice Site 171 623 3 15
Genomic Location (Zv9):
Chromosome 15 (position 13626780)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14634931
GRCz11 15 14570888
KASP Assay ID:
554-6787.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGGCAAGGGAGGCAAAACAGAACATTGCCAGGCCTGTTAGACAAAAGG[T/G]GAGGACATCTGAATTTTTTTTTTTTTTTGTCAAACATTACAAGGACATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6367
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006829 Nonsense 316 624 8 15
ENSDART00000140621 Nonsense 316 623 8 15
Genomic Location (Zv9):
Chromosome 15 (position 13633410)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14628301
GRCz11 15 14564258
KASP Assay ID:
554-5016.1 (used for ordering genotyping assays)
KASP Sequence:
AGAAACTCTCATCAWTTGAGGAAAAGCCTTTTGCTGCTGCCTCCATTGGA[C/T]AAGTTCATCATGGAGTTTTGCCTGRTGGGAAGGAAATCGCTATGAAGATA
Associated Phenotype:
Not determined