Busch Lab

ZMP

cry4

Ensembl ID:
ENSDARG00000011890
ZFIN ID:
ZDB-GENE-010426-7
Description:
cryptochrome 4 [Source:RefSeq peptide;Acc:NP_571862]
Human Orthologues:
CRY1, CRY2
Human Descriptions:
cryptochrome 1 (photolyase-like) [Source:HGNC Symbol;Acc:2384]
cryptochrome 2 (photolyase-like) [Source:HGNC Symbol;Acc:2385]
Mouse Orthologues:
Cry1, Cry2
Mouse Descriptions:
cryptochrome 1 (photolyase-like) Gene [Source:MGI Symbol;Acc:MGI:1270841]
cryptochrome 2 (photolyase-like) Gene [Source:MGI Symbol;Acc:MGI:1270859]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa8815 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa8815
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082365 Nonsense 53 418 2 9
ENSDART00000105873 Nonsense 74 579 2 11
ENSDART00000121551 Nonsense 53 418 2 10
ENSDART00000126053 Nonsense 74 582 2 12
Genomic Location (Zv9):
Chromosome 22 (position 811602)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 814514
GRCz11 22 831412
KASP Assay ID:
2261-6194.1 (used for ordering genotyping assays)
KASP Sequence:
CCTGGACCGTGTGTTCCTGCAGGGGGCRATGCACATGGGTGCGYTACGCT[G/A]GCGGTTTCTTCTCCAGAGTCTGGAGGATCTGGACACTCGTCTGCRGGCGA
Long Flanking Sequence:
TCATCTTTTGTTGTTGATTTATTTCCATGTTTTAGACCTTTTAATGATGGCAAACACATGTTTTTTTATACTTAGCACAGTATTACCATGTTTTTGTTACAATCCTAATGGCATGTTTTTTTTACATTTACCATAGTAATACTATTTATTTTGGAAATTAGCATGTTTTCAATAGCATGCTTTTGAAGTAATTCAATTTTGATCCTTATCTTGATAGCAATAGTATGTTTTTTATTTATTTTTTACCATGCTAACACCATGTTTTGAGCCTTCATTTTACCAAAGTTCATTGTTCTGTTTCAGCCCGTCTGAAGTGTTTTCATCTTGGAGAAAGTCGGTCGCCATGAGTCACCGCACCATCCATCTGTTTCGCAAAGGCCTGCGCCTGCATGATAACCCCAGCCTGTTGGGGGCGCTAGCGTCCTCCTCCGCGCTCTATCCAGTGTACGTCCTGGACCGTGTGTTCCTGCAGGGGGCAATGCACATGGGTGCGTTACGCT[G/A]GCGGTTTCTTCTCCAGAGTCTGGAGGATCTGGACACTCGTCTGCAGGCGATTGGATCGCGACTTTTTGTCCTGTGCGGGTCGACGGCTAACATCCTGCGGGAGCTCGTAGCACAGTGGGGAATCACACAAATCAGTTACGACACTGAAGTGGAGCCGTATTACACACGCATGGACAAGGACATACAGACAGTGGCGCAGGAAAATGGACTGCAGACGTACACATGTGTATCGCACACGCTGTACGACGTCAAGAGGTATGATGACAACTTTATTAGCTTAAAGCTACCGCGAAGAGCTTCGAAATGTGTATTTTGTATTTGATGTTTGATGTAATTTCAACTAAAGCATGAAGATAGGGCGGGTATATAGTAGCTACTCCTCCTTTTTACAAAACAGCCAATAGTATTTTGTTTTTGTCACAATGGCAAGTCACAGTTGAGCTTAAGCACATCAAATGAACAGCCAATGGGAAGAAGGGGGAGGGGCATGTCAGACACAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29681
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082365 Essential Splice Site 265 418 None 9
ENSDART00000105873 Missense 425 579 8 11
ENSDART00000121551 Essential Splice Site 265 418 None 10
ENSDART00000126053 Missense 428 582 9 12
Genomic Location (Zv9):
Chromosome 22 (position 802816)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 805728
GRCz11 22 822626
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTGTGAACGCCGGGAACTGGATGTGGCTGTCCGCTAGTGCGTTCTTCC[A/G]CAAATACACCAGGATCTTCTGTCCTGTGCGTTTCGGCCGTCGGACTGACC
Long Flanking Sequence:
CGCATCTTTGCATTGACTTAACGTGTATCATGCTCGACGCTTCTTCCGCATCTGGTGACAGTTAAATTTTTCTTCTTTGCAGGCTCAGACGGGTTTTCCCTGGATCGACGCCATCATGACGCAGCTACGGCAGGAGGGCTGGATCCATCACCTGGCGCGTCACGCCGTGGCCTGTTTTCTGACTCGCGGCGACCTGTGGATCAGCTGGGAGGAGGGCATGAAGGTGCGGCCATCTACTAGCCTGGCATATGTGACGCAGCATTTTCGACAGTGTTTGCAGATGTGTAAACGTGGATTGATGAAAATTTTATTGAGTAAATATGAAACCTTTTCAAAAAGCAAGGGAAAAACAGGCCGTATTAGTGTGTGTTATGGTGATGTGCACAGGTGTTTTACACAGGTGTGTGTGTGTTCTCAGGTGTTCGAGGAGTTCCTGTTGGATGCAGACTACAGTGTGAACGCCGGGAACTGGATGTGGCTGTCCGCTAGTGCGTTCTTCC[A/G]CAAATACACCAGGATCTTCTGTCCTGTGCGTTTCGGCCGTCGGACTGACCCTCAAGGAGAGTATCTGAGGTGAGACCACACCCACTTCATGTAATATTCATAAGATTATTTGATTTGTCACACCTACGGTACCCAGTACCCATGTGCTTCACCTGATCTGCCAAGCTTCACGTCAACTACGTCATTACTAATGAATAAATCAAAATAATATTTTTTTTAGTTCCGTTAAATGTTGTTAAGCATTTTGTAACGTAAACTCACATTAGTAGAATTGAACACTGTAAAAAGCACATAATCAGTACCTGAGGTGATTGTTGTCATAGTAGTTCATGCAGTTGTTCAGCCACAAGTAATACTAACCGTTTTTAATATTACAAATTTCAGGTGATGGTTTACCAAAAAAACCCGCTCGTGTTGGTGTCGTCAATCTGGCAACCTGCCTTTTCGTGGAGTAGCTGAAATTGTTTTAAATTTGAACTGCAATATCTAGTTCGATCACT
Associated Phenotype:
Not determined