Busch Lab

ZMP

MFN1 (4 of 4)

Ensembl ID:
ENSDARG00000011884
Description:
mitofusin 1 [Source:HGNC Symbol;Acc:18262]
Human Orthologue:
MFN1
Human Description:
mitofusin 1 [Source:HGNC Symbol;Acc:18262]
Mouse Orthologue:
Mfn1
Mouse Description:
mitofusin 1 Gene [Source:MGI Symbol;Acc:MGI:1914664]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa39754 Nonsense Mutation detected in F1 DNA Not yet available
sa12728 Nonsense Available for shipment Available now
sa19663 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39754
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026201 Nonsense 134 527 4 13
Genomic Location (Zv9):
Chromosome 2 (position 4571164)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5428606
GRCz11 2 5340590
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCAGTCTGCCGTCAAGACCAAGTTTGAGCAGCACACAATCCGAGCCTGG[C/T]AGATCATTGAGTCGGTCAAGGCTATCATGGATGCCATCAATATTTCTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12728
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026201 Nonsense 460 527 11 13
Genomic Location (Zv9):
Chromosome 2 (position 4559346)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5416788
GRCz11 2 5328772
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCAGGCCGTCGCACACWTCATCAGTGGAGACTCTGGTCAGCAGGTGCAA[C/T]AGTAAGTGCCAAYAATAATCWAATATTCATTCATTNNNNTTCTTGTCGGCTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19663
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026201 Nonsense 472 527 12 13
Genomic Location (Zv9):
Chromosome 2 (position 4555339)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5412781
GRCz11 2 5324765
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCTCTCTGTCTGCAGGGAGATGGTGGCCGTCTTTGCCCGCATGTGCCAA[C/T]AGGTCGACAAGAGCGAGATGGAGCTTGAAACGGAGATCCGCAGACTCAGT
Associated Phenotype:
Not determined