Busch Lab

ZMP

ednra

Ensembl ID:
ENSDARG00000011876
ZFIN ID:
ZDB-GENE-010906-2
Description:
endothelin-1 receptor [Source:RefSeq peptide;Acc:NP_001092915]
Human Orthologue:
EDNRA
Human Description:
endothelin receptor type A [Source:HGNC Symbol;Acc:3179]
Mouse Orthologue:
Ednra
Mouse Description:
endothelin receptor type A Gene [Source:MGI Symbol;Acc:MGI:105923]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa19531 Essential Splice Site Available for shipment Available now
sa1973 Nonsense F2 line generated Not yet available
sa11317 Nonsense Available for shipment Available now
sa13839 Nonsense Available for shipment Available now
sa19532 Nonsense Available for shipment Available now
sa32714 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa19531
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010632 Essential Splice Site None 422 1 8
ENSDART00000128557 None None 24 None 2

The following transcripts of ENSDARG00000011876 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 36373894)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 35933752
GRCz11 1 36665779
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGACTGACTGACTGACGGGATCCTGGGGAAGGCAGACATTTAAGGAGCG[G/A]TAGGTGAAAAACCAGGAGACATTTATAATTCATAAGTGTAGCAGTTTACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1973
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010632 Nonsense 20 422 2 8
ENSDART00000128557 Nonsense 20 24 2 2

The following transcripts of ENSDARG00000011876 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 36382796)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 35942654
GRCz11 1 36674681
KASP Assay ID:
554-2675.1 (used for ordering genotyping assays)
KASP Sequence:
TACGACGCTACAATTGTTTCTGCTAATGGCCGTTCTGGCCACTGGTGGAT[T/A]ATGTCTGATAAAYGGCACAGAGGAAGCCCAGGATGCTTTATATCCAAACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4855
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010632 Nonsense 66 422 2 8
ENSDART00000128557 None None 24 None 2

The following transcripts of ENSDARG00000011876 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 36382935)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 35942793
GRCz11 1 36674820
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCCCCACAAAAAAAGACGCTTCGGTTTTCAATATGAAGCATCCACCCTG[T/A]AGGGATCCCACTTCCATCAAGCTTTATTTTAAGTATATCAACACAATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11317
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010632 Nonsense 163 422 3 8
ENSDART00000128557 None None 24 None 2

The following transcripts of ENSDARG00000011876 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 36391010)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 35950868
GRCz11 1 36682895
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGACAGCTCCTTTGGWCTCTTCCTGTGCAAACTTGTGCCATTCCTCCAR[A/T]AAGCGTCTGTTGGGATTACAGTGCTCAATCWATGTGCTTTGAGTGTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13839
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010632 Nonsense 189 422 4 8
ENSDART00000128557 None None 24 None 2

The following transcripts of ENSDARG00000011876 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 36399013)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 35958871
GRCz11 1 36690898
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTATGTTTTGMATGTCTCAATCAGGTACAGGGCTGTAGYCTCCTGGAGC[A/T]GAGTGCAGGGGGTCGGCGTTCCTCTTCTTACTGCCATCGAGATCTTCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19532
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010632 Nonsense 283 422 5 8
ENSDART00000128557 None None 24 None 2

The following transcripts of ENSDARG00000011876 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 36401303)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 35961161
GRCz11 1 36693188
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGCACGGCTATTTTCTACACACTCATGACCTGTGAAATGCTGCATCAC[A/T]GAGATGGAAGCCTTCGCATCGCCCTCAGTGAACACCTTAAGCAGGTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32714
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010632 Nonsense 372 422 7 8
ENSDART00000128557 None None 24 None 2

The following transcripts of ENSDARG00000011876 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 36406153)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 35966011
GRCz11 1 36698038
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGACTGTGAACTCTTGCATCAACCCCATCATTCTCTACTTTGTCAGCAAG[A/T]AGTTCAAGAATTGCTTTAAGGTGAGTTGTTTATTCCTTCATTAAAAAAAC
Associated Phenotype:
Not determined