Busch Lab

ZMP

fgd4

Ensembl ID:
ENSDARG00000011830
ZFIN IDs:
ZDB-GENE-050420-347, ZDB-GENE-050420-347
Description:
FYVE, RhoGEF and PH domain containing 4 [Source:RefSeq peptide;Acc:NP_001171404]
Human Orthologue:
FGD4
Human Description:
FYVE, RhoGEF and PH domain containing 4 [Source:HGNC Symbol;Acc:19125]
Mouse Orthologue:
Fgd4
Mouse Description:
FYVE, RhoGEF and PH domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2183747]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa43057 Nonsense Mutation detected in F1 DNA Not yet available
sa36587 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23242 Nonsense Available for shipment Available now
sa23243 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa43057
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018144 Nonsense 181 728 6 18
ENSDART00000125382 Nonsense 181 728 3 15
Genomic Location (Zv9):
Chromosome 18 (position 11662776)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12245606
GRCz11 18 12214324
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACCAACGAGCAGAAACTCTACAAAATTGCAAATGAACTTCTGCAGACA[G/T]AGAAGGCCTACGTTGCACGACTGAACTTATTAGATAAGGTAAGTCATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36587
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018144 Essential Splice Site 242 728 8 18
ENSDART00000125382 Essential Splice Site 242 728 5 15
Genomic Location (Zv9):
Chromosome 18 (position 11664981)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12247811
GRCz11 18 12216529
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGAGTGTTTGGTTTAATTAATGGTCTTAATGCTCTGAAATTTACCTCCA[G/T]GACGTCGACACCTCGCATTGGAGACATCCTACAGAAGCTCACGCCCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23242
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018144 Nonsense 262 728 8 18
ENSDART00000125382 Nonsense 262 728 5 15
Genomic Location (Zv9):
Chromosome 18 (position 11665042)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12247872
GRCz11 18 12216590
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTCGCATTGGAGACATCCTACAGAAGCTCACGCCCTTCTTGAAGATGTA[T/A]GCAGAGTATGTGAGGAACTTTGATCATGCCATGGATCTGCTGAAGCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23243
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018144 Essential Splice Site 294 728 8 18
ENSDART00000125382 Essential Splice Site 294 728 5 15
Genomic Location (Zv9):
Chromosome 18 (position 11665139)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12247969
GRCz11 18 12216687
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGGATAGATCGCTCGCCTCCATTTAAAGCTATCATTCTGGATATACAG[G/T]TGAACACTGATGCAGATTGCTATTCTTGAAAAGAGTTCTTTTAAATAGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa220
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018144 Nonsense 317 728 9 18
ENSDART00000125382 Nonsense 317 728 6 15
Genomic Location (Zv9):
Chromosome 18 (position 11667504)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12250334
GRCz11 18 12219052
KASP Assay ID:
554-0122.1 (used for ordering genotyping assays)
KASP Sequence:
GCAATCTGACGCTGCAGCACCACATGTTGGAGCCGGTTCAGAGAGTGCCA[C/T]GATACGAGATGCTGCTTAAAGACTATCTGAAGAAACTCCCTCCAGAGCAC
Associated Phenotype:
Not determined