Busch Lab

ZMP

plod2

Ensembl ID:
ENSDARG00000011821
ZFIN ID:
ZDB-GENE-070326-1
Description:
procollagen-lysine,2-oxoglutarate 5-dioxygenase 2 isoform 1 [Source:RefSeq peptide;Acc:NP_001007378
Human Orthologue:
PLOD2
Human Description:
procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 [Source:HGNC Symbol;Acc:9082]
Mouse Orthologue:
Plod2
Mouse Description:
procollagen lysine, 2-oxoglutarate 5-dioxygenase 2 Gene [Source:MGI Symbol;Acc:MGI:1347007]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa24440 Nonsense Available for shipment Available now
sa1768 Nonsense Available for shipment Available now
sa39433 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30030
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005901 Nonsense 269 754 8 20
ENSDART00000106488 Nonsense 269 733 8 19

The following transcripts of ENSDARG00000011821 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 5364559)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 5253052
GRCz11 24 5284839
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCCACAGGTATACTTTAACTACCTGGCCAACTACATTCCCAATGCATG[G/A]AACTATGAGCGCGGCTGCACCATCTGTGACCAAGACATGGTGGATTTGTC
Long Flanking Sequence:
GTTTCAGTATCTTGATCTAAGATTAAAAACATGCCGTTCTCATAAGCCAACATCAAATAAGCCAATTTATGTATTTATTTATTTAGCAAGAACACTATATTTCCCCTTTAGATGGCTTAATCTGCATAATCTGCCTATTTAAACACAAACTGACCTTCAGTTAAAGTTTCCGTCCCTGCGACGCTGTCCTGTAAATTCCCAGCTGAGATACAAAAACGCATTCTTTGATGTGTGCAGTGCTACAAAATACCAGTCCAGCTATAATTACAGCTCTACTGACAGTAGTTTATAAAAATGTGACAGCAGGATTCATTTTTGAGTAGTTGTCCTGACCAAAATTGGATTTAACTACAGGCTGGGTTCAAATATTGATGGACATTTCCTTTTCAGGAGTATGTCGTCATGAATATTTTAAAGGTTTCCTTTATCTAACTACCTATTTGTTGTTATTCTCCACAGGTATACTTTAACTACCTGGCCAACTACATTCCCAATGCATG[G/A]AACTATGAGCGCGGCTGCACCATCTGTGACCAAGACATGGTGGATTTGTCTCAGCTTAAAGTGAGTCATCCAATGAAAGCCACAGTGGCTGTTTTTGTTCTTTTTCCTCTCAGCACCATAAAGGTCTACCCTAAAAGCGCCATTTAAAGAAAAAATGAAACATTTCCAGCTCTATTAATACATGCCTGTAAGTGAATAACTAGTTCCTCTTCAGTTTTCACTTTGAGATAAGCCAAGAGAAGTGAGGTTTGGGAGTCGTATCCAACAGTAACAAGCGTCTTATCCACCCCATGTCCCTTCACACACTCCTTAAATGCCCATGAGGAGCCACTTGAGGAAGAGGAAGCTGTGCACTGCTGTGGTGCAGGAAATGGCTTTTTGGGTTTTAGGACGGTTTCACTTACTGGGGTGTTGCTGTCAACCAGACCTCTGTTTAGCGGGTGGCTCACTGTGGGGTTTTATCCACAGGGCAACTTACAGTGGTTGTTCTGAAAATTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24440
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005901 Nonsense 614 754 18 20
ENSDART00000106488 Nonsense 593 733 17 19

The following transcripts of ENSDARG00000011821 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 5387102)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 5275595
GRCz11 24 5307382
KASP Assay ID:
2261-8378.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATCATTAACTGTTGACTGATTATTGTCCTTCTTTTTATCTTCACAGGAT[A/T]AGCGTATCACCGGAGGCTACGAAAGCGTCCCGACAGATGACATTCATATG
Long Flanking Sequence:
TCCTGAATTATTAGCCTCCTGTTTAATTCATGTTTATCGCAAAGAAGATTTTTGTAATACATTTTTAAACATAACAGTTTTAATAACTTATTTCTTCTTTGCCATGATGACAGAACATAGTATTTGACTATTTAGGATACTAGTATTCAGCTTAAAGTGACATTCAAAAGCTTTAAATTAAGTAGGTTAGGATAATTAGGCAAATCATTGTATATATAATGCTTGAGGGGGTAATGATATTGACCTTAAAATGGTTGTCAAAAAATTAAAAACTGCTTTTATCCTAGCCATAATAAAACTATTAAGACTTTCTCCAGACGAAAAAATTATGTAGGAAATACTGTGAAAAGTTCCTTGCTCTATATAACGTAATTTGGGAAATATTTGAAAAAGAAAGGTGGAAATCAATAGATTTTCAGTACACAGCAGCACAACTGCTGATAGGGTTTTTATCATTAACTGTTGACTGATTATTGTCCTTCTTTTTATCTTCACAGGAT[A/T]AGCGTATCACCGGAGGCTACGAAAGCGTCCCGACAGATGACATTCATATGAAACAGATCAATTACGATCAGGAATGGCTGCACTTTATCAGAGAATTTATCTCCCCTGTCACTCTCAAGGTTTTCTCTGGCTATTACACCAAGGTGAGACCGTCTGCCTAGTCTAGACCCAGACATAATCATCTGCTAAAGGGATAGATCACCTCCAAAAAAAAAAAAAAAAGAAGAAAAATGAAGCATCACTTGTTTATTTTCATACCAAAACGTGAAAGAAATGTCCTGCTTATCCATCCAGTATAATAATAGAGAATGCAAACAATGGCATCACATAAAAAAGATGCAAAAGAACGATACTATGCAAGCGTTCTTGATGTACACAAAGCAAAACGTGCTCATCAAAAACACTCACCCTTAAACATATCTCTGCATTTATGATATTATTAGAGAACATAATGATTCCAGATAAACAGAAATGCATCACAAAACCTTCTCTGAGGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1768
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005901 Nonsense 679 754 19 20
ENSDART00000106488 Nonsense 658 733 18 19

The following transcripts of ENSDARG00000011821 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 5391267)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 5279760
GRCz11 24 5311547
KASP Assay ID:
554-1761.1 (used for ordering genotyping assays)
KASP Sequence:
TATGCGATTATGAACTTTGTGGTGAAGTACACTCCAGACAGACAAGCCTA[T/A]CTTCGACCACATCACGACTCCTCAACGTTCACCATTAACWTCGCTCTCAA
Long Flanking Sequence:
TGTAATAAAAAAGTAAATACAAAACACAAAACAGAATTAAATGCACAATACAATGTAAGCACTAATGAAAATCTTTAAAAAAGCAAGTACAGAACTCATCGCAGCAAAGTAGTGTGTATTCTTGGTATGCTACACTTGAACTTTACATTTTAGCTATTCTTTGCAGAAATATGAGCATTTTTTTTCCTTTGATGGCTTAAAAATCTCAATAGATCAAGGCAAATTTAATTGATCATGTCACGACTCATTTAGTAGCACTTAGGTAGTCCAAACCTTTCCATATCTTCCAAATCCACATGAATAGTTTTATGGGATCGTTTTATACCCATTTAAACTATGATCTGTTTTTTGCATGGAAAAGACTTTGGAACTGTAAAACTTTGAATCACAAGTAAATCAGACACATTTGAGAGGGTTTTATTTGTATCTCTCTTCTTTCCCCCCCAGGGCTATGCGATTATGAACTTTGTGGTGAAGTACACTCCAGACAGACAAGCCTA[T/A]CTTCGACCACATCACGACTCCTCAACGTTCACCATTAACATCGCTCTCAACAACAAAGGCTTAGATTTCCTGGTAAGTTTGAATAATATTAGCCTCGTTATTTTTCTAAAATAGGCTTAAATACATCTTACACCATGTCCTAACTCCACGTGATGCTACAACACACAATAAATGGTATTTTTAGTATTATAAGTATTATTATTATAAAAGTATTACTATTTCTGCAATATTGCAGCAAAACAACAGCATAAACTACTATGACAATGATTACCTCAGGTACTGATTATGTGCTTTATTAAGTGTTTAATGCTACCAATGTGACTTAAAATCCATTTTGCATGACATTTACAGCATTGCCATAAAGCAGCAGCAAATACCAGCAATAACTAGTAACATCCATCACTCATTAGCCTATCAATAATGTTAAAGAGGTTTACTGTGTATTAATTAGATTAAAAAACTTAATTTGGTGTGGACAGTCACTGTCTCTGGAATTTTGT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa39433
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005901 Nonsense 712 754 20 20
ENSDART00000106488 Nonsense 691 733 19 19

The following transcripts of ENSDARG00000011821 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 5393384)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 5281877
GRCz11 24 5313664
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTTTGTGCTTCTTCTATTTCAGGGCGGAGGTTGTCGATTTCACAGATA[T/A]AACTGCTCCATAGAATCTCCTAGAAAAGGCTGGAGCTTCATGCATCCAGG
Long Flanking Sequence:
ATACATGCACAATAAAACAATCCGCCTGCACGTAAAATCAGTAATTTTACTTAAAATAACGCCCGTTAAATTACTGAAATATACCTTAAAATAACAGATATTAAATTACAGAAATTGCCTTAAGTTTGAATTTCTGTTAAAGTTCTGTAATTTAATTTTCATTATTTTACGATAAATTTGTAAAATAAAATTACAGTTTTTTTTTTTTACAGTGTACTATAACTACAAGCTACAATATTTTAACAATACAGGACTAATCGCAGCAAAGTAGTGTTACAATCCTGCTTTAAATTTAGCTATTCTTTGGAAAAATGCATTTTTTCACCTTGATTTTGTGTCTGTTGTGAAGTGAACTTCACGCATGAACCAACAGCCTAATTACATAAGAATATCACAATTTAAGGCACGTCTGGTGTGAGCGCCCCATTAGAATGCCATGTACTAAAACTAAACTTTGTGCTTCTTCTATTTCAGGGCGGAGGTTGTCGATTTCACAGATA[T/A]AACTGCTCCATAGAATCTCCTAGAAAAGGCTGGAGCTTCATGCATCCAGGTCGACTCACTCACCTTCACGAAGGACTGCCGGTGACCAATGGCACGCGCTACATAGCAGTGTCTTTCGTAGATCCCTAAATTCCCCTCATCCTTCTAGGAATCTTTGAGATGTTTTGTCAATTCTGTTTTGTTGTTGGTGGTTTTTACTGATTTATTCCTGGCTTACATGTCGTGGTGCCTGTTTTATTTGCTGTCTTTTAAAACGTTTACTACTGTCAAGAGAGAAAATGCTGTTCAACACATTCGTAAGACATATCAACACACACACAAACACAGACGAGCATTCACTCCAGCAGATTTTCGCAAATCTTAGTTGTTACTTTAAATTAGAGATTTCCCACAATTTTTATACTTCGACTTTGGCCAAATGTCCTTCCTGAAAGTTTCTATTTGCTAAATTGGAAATTGTGATTTCCCAAATTGTGCTTTTAAATTATTTTCATCACCCC
Associated Phenotype:
Not determined