Busch Lab

ZMP

wars2

Ensembl ID:
ENSDARG00000011801
ZFIN ID:
ZDB-GENE-050306-26
Description:
tryptophanyl-tRNA synthetase, mitochondrial [Source:RefSeq peptide;Acc:NP_001013341]
Human Orthologue:
WARS2
Human Description:
tryptophanyl tRNA synthetase 2, mitochondrial [Source:HGNC Symbol;Acc:12730]
Mouse Orthologue:
Wars2
Mouse Description:
tryptophanyl tRNA synthetase 2 (mitochondrial) Gene [Source:MGI Symbol;Acc:MGI:1917810]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa41400 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41399 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41400
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018570 Essential Splice Site 121 364 2 6
Genomic Location (Zv9):
Chromosome 9 (position 22118048)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21273834
GRCz11 9 21084703
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCCTGTGGAATCGACCCGACACGCTCCATACTTTTCCAGCAGTCTCAAG[T/C]GAGTCCTACATTAAAGTCCCCATGAACTGGAAGCTGCGACCTTTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41399
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018570 Nonsense 204 364 5 6
Genomic Location (Zv9):
Chromosome 9 (position 22109561)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21265347
GRCz11 9 21076216
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCACTTGGAGCTCGCCCAGGACTTGGCCCGTATCTTTAACAACCAGTA[C/A]GGAGAGTTCTTCCCTGAGCCTCGTGCCCTGCTCAGTATGTTTGGACGTTC
Associated Phenotype:
Not determined