Busch Lab

ZMP

si:dkeyp-20g2.6

Ensembl ID:
ENSDARG00000011783
ZFIN ID:
ZDB-GENE-030131-3432
Description:
stromal antigen 2 [Source:RefSeq peptide;Acc:NP_001093498]
Human Orthologue:
STAG2
Human Description:
stromal antigen 2 [Source:HGNC Symbol;Acc:11355]
Mouse Orthologue:
Stag2
Mouse Description:
stromal antigen 2 Gene [Source:MGI Symbol;Acc:MGI:1098583]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa11496 Essential Splice Site Available for shipment Available now
sa9551 Essential Splice Site Available for shipment Available now
sa20396 Nonsense Available for shipment Available now
sa13330 Nonsense Available for shipment Available now
sa33585 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa11496
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045782 Essential Splice Site 160 1201 4 31
ENSDART00000137655 Essential Splice Site 209 1246 7 34
ENSDART00000045782 Essential Splice Site 160 1201 4 31
ENSDART00000137655 Essential Splice Site 209 1246 7 34
Genomic Location (Zv9):
Chromosome 5 (position 25181070)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23008335
GRCz11 5 23512135
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTGTCAGACTCACAGGTCAGAGCGTTCAGACACACCAGCACTCTGGCAG[G/A]TTGGTGAACTCRGGCTGGATMTCATTYAGTTTTAAGCATATTACCAMAGW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9551
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045782 Essential Splice Site 160 1201 4 31
ENSDART00000137655 Essential Splice Site 209 1246 7 34
ENSDART00000045782 Essential Splice Site 160 1201 4 31
ENSDART00000137655 Essential Splice Site 209 1246 7 34
Genomic Location (Zv9):
Chromosome 5 (position 25181070)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23008335
GRCz11 5 23512135
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTGTCAGACTCACAGGTCAGAGCGTTCAGACACACCAGCACTCTGGCAG[G/A]TTGGTGAACTCRGGCTGGATMTCATTYAGTTTTAAGCATATTACCAMAGW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20396
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045782 Nonsense 268 1201 7 31
ENSDART00000137655 Nonsense 317 1246 10 34
Genomic Location (Zv9):
Chromosome 5 (position 25177760)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23005025
GRCz11 5 23508825
KASP Assay ID:
2259-5724.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCATGTGGATGAAGATGTACAGTGAGGCGTTTCTTAATGACAGTTACCTG[A/T]AGTACGTGGGCTGGACCATGTATGATAAGGTATCAAACGCATGCACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13330
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045782 Nonsense 478 1201 13 31
ENSDART00000137655 Nonsense 527 1246 16 34
Genomic Location (Zv9):
Chromosome 5 (position 25173113)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23000378
GRCz11 5 23504178
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCATGWTCTGTGCTGTCAGACAGACTTGTGAGTGTCACCCACCCATCGGT[C/T]GAGGCACTGGGAAAAGGGTAAGACACACAAAACATTTWGATTTTGCTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33585
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045782 Essential Splice Site 483 1201 13 31
ENSDART00000137655 Essential Splice Site 532 1246 16 34
Genomic Location (Zv9):
Chromosome 5 (position 25173094)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23000359
GRCz11 5 23504159
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGACTTGTGAGTGTCACCCACCCATCGGTCGAGGCACTGGGAAAAGGG[T/C]AAGACACACAAAACATTTTGATTTTGCTATTTTAGTAAGGATATCCCATG
Associated Phenotype:
Not determined