Busch Lab

ZMP

u2af2b

Ensembl ID:
ENSDARG00000011740
ZFIN ID:
ZDB-GENE-040426-1881
Description:
U2 small nuclear RNA auxiliary factor 2b [Source:RefSeq peptide;Acc:NP_991252]
Human Orthologue:
U2AF2
Human Description:
U2 small nuclear RNA auxiliary factor 2 [Source:HGNC Symbol;Acc:23156]
Mouse Orthologue:
U2af2
Mouse Description:
U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 2 Gene [Source:MGI Symbol;Acc:MGI:98886]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa43235 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa3012 Essential Splice Site F2 line generated Not yet available
sa14700 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43235
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023571 Essential Splice Site 165 475 6 13
Genomic Location (Zv9):
Chromosome 19 (position 10933230)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10391769
GRCz11 19 10310694
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCAGGCTCGCAGACTTTACGTTGGCAACATCCCATTTGGCATCACAGAG[G/T]TGTTGAACGAACACTATTCGCACACTAGAATTACTCTGCGGGGCTTTTGT
Long Flanking Sequence:
TTCAAAAAAGAAATCAATGGATCAAAGGTACGATAATTCTCCGAAATATTGCGCAGCTCTAATCAGTCTAAATTTTTCTGTCCACATGGATGGTGCTCAAACCAAATTAGTGAGGTGACTGTTGAAGCAGAACGAGTTCAGTGTGTGATAATCGGCATGTGCTAAACTCTTCCATCTGTGCTCATCCTCGGTTAAGTAAGCTGCACAGACACGGATGTTTGCGAGAGAGCCCAATGCAAAAATTAGTGTACATAGCCCTTAACTACGTTTTATTCTCTTTCTGTCTTCTATTACTACTCAGTAACACATATATAATTTATGAATTCATATTTTGTTGTTTTCCCTCAGCTGCTGGTCAAATCCCCGCTACCGCTTTGCTGCCCACCATGACGCCAGACGGCCTGGCAGTAACGCCGACCCCGGTGCCTGTAGTAGGCAGTCAGATGACTCGCCAGGCTCGCAGACTTTACGTTGGCAACATCCCATTTGGCATCACAGAG[G/T]TGTTGAACGAACACTATTCGCACACTAGAATTACTCTGCGGGGCTTTTGTAAACTGATCCAAATAGAGAACACTAGCATGCTTGGATGCATTATGCAGAAGCATATTGGATATTTATTTTAGCATACTCCGATATTTTCATATTTAGATTATTTTACATTCATCTACAGCTCACCTAAAGTTAATCAATCTTTAGCTAATTTAAATTTGTTAATATTACACTACCAGACAAAAATCTTTTCGTCGATCCCAGCTGTAGGAGCAACAAGTTATAACTTGACTTCTGGTCAAAAAGTAGCAATTTTCAGATGAATTATCTAAAGAACTGCAACCTAATCATCACAAATAGTGCAGAAGACCTACTAGAACCCACATAGACCCATGATTCTCACAGATGTCAGTCAGGTTTGGTGAAGGAAAAATCATGGGTAGGGGTTACATTCAGTATGGGGGCGTGCAAGAGATCTGCAGAATAGATGGCAACTTCAACAGCCTTAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3012
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023571 Essential Splice Site 250 475 8 13
Genomic Location (Zv9):
Chromosome 19 (position 10929353)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10387892
GRCz11 19 10306817
KASP Assay ID:
554-2772.1 (used for ordering genotyping assays)
KASP Sequence:
CTATCAGCCATTACCTGGCATGAGCGAGAACCCCAGCGTTTATGTGCCAG[G/A]TAAACCCACAATACAATTCTCTTCTAAGATATCAAACTACAACAAATATG
Long Flanking Sequence:
ATTTATTACCCTTGGTCCGGACCAAATGAAGCGAACTACAGATGTGAAAGAACCCATAGACTTCCTGATAAACTGACGCCAAATATCAAAGAGAAAATGGACTTTGCTATAGTAGGAGAAGCCGCTGAGGGCCTTTTTCTTATAAAATAAATATATGCACCTCAGAAGACGAAATGCAATGAACGCATGGTGGTGCCGATTTTATTATGCACATAATGCCAATTCCATTTGTTATACAATATTCCAATAATGCACATAAAAAGATGAGTAGATAAAAAGAAAGCTACTCACAGGGGCTTATGTTGCCTATGATTTGGTATATTTGGTTGTTGACTGTATTCTTCTTTCATTAATTCATCAGTTCCGATCAGTGGATGAGACCACGCAGGCCATGGCATTCGATGGCATCATCTTCCAGGCACAGAGCTTAAAGATTCGCAGACCGCATGACTATCAGCCATTACCTGGCATGAGCGAGAACCCCAGCGTTTATGTGCCAG[G/A]TAAACCCACAATACAATTCTCTTCTAAGATATCAAACTACAACAAATATGACTTTTGATTTTTATTTTTTTCCTTTATTACAAATGTCTGGTGTCCTTATGCATCTGTAAAGCAGTCCAATTTCAGGGTAAACTTATTTTCATTTAAAGTTGACTTTAGGAAAATCTTGCTGTTATTTCTTATTCATTTAAACCCTTTTACTTTAGTCTCTTATTCACCTTTTTTTTGTGCCTGCCAGTTGTGTGTTGATGAATGTTGTCCATCTGCTCCACAGGTGTGGTGTCTACTGTTGTACCAGACTCTATTCACAAGCTGTTCATTGGAGGTTTACCAAACTATCTCAATGACGACCAGGTTGGTTACAAATGCTTTCTGGTTGAAAGTCTGTGACGCATGCATTGGCAGTCATAAATTTATAAGATGTTTTGTACTTGCATTAAAGGGATTTCTCATTTTGAAAAATGAACATTTATACAACATCAATGGTTCCAAACCTTTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4790
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023571 Essential Splice Site 277 475 9 13
Genomic Location (Zv9):
Chromosome 19 (position 10928998)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10387537
GRCz11 19 10306462
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCACAAGCTGTTCATTGGAGGTTTACCAAACTATCTCAATGACGACCAG[G/A]TTGGTTACAAATGCTTTCTGGTTGAAAGTCTGTGACGCATGCATTGGCAG
Long Flanking Sequence:
CATCAGTTCCGATCAGTGGATGAGACCACGCAGGCCATGGCATTCGATGGCATCATCTTCCAGGCACAGAGCTTAAAGATTCGCAGACCGCATGACTATCAGCCATTACCTGGCATGAGCGAGAACCCCAGCGTTTATGTGCCAGGTAAACCCACAATACAATTCTCTTCTAAGATATCAAACTACAACAAATATGACTTTTGATTTTTATTTTTTTCCTTTATTACAAATGTCTGGTGTCCTTATGCATCTGTAAAGCAGTCCAATTTCAGGGTAAACTTATTTTCATTTAAAGTTGACTTTAGGAAAATCTTGCTGTTATTTCTTATTCATTTAAACCCTTTTACTTTAGTCTCTTATTCACCTTTTTTTTGTGCCTGCCAGTTGTGTGTTGATGAATGTTGTCCATCTGCTCCACAGGTGTGGTGTCTACTGTTGTACCAGACTCTATTCACAAGCTGTTCATTGGAGGTTTACCAAACTATCTCAATGACGACCAG[G/A]TTGGTTACAAATGCTTTCTGGTTGAAAGTCTGTGACGCATGCATTGGCAGTCATAAATTTATAAGATGTTTTGTACTTGCATTAAAGGGATTTCTCATTTTGAAAAATGAACATTTATACAACATCAATGGTTCCAAACCTTTGTGAGTTTTTCTGTTGAAAATAAAGAAAGATAGTTTGAAGAATGTTGAAAACTGGTAGCCACTGACATCCATAGTACAAAAAAAAACATACTGTAAAAGCCAATGTTTACAGATTTTTAACAGTACACAGAGTAAAAGATGAGTACATTTTATTTTTTTTTGATGAACTACCTCTTTAACTTGGCCAAAAATATAGTAAAAACAAAAATATTTAAAAATATTACAATTTATAATGCATTGTGTTTGAATATATTTAAAGTAATTTATTCCTGTTATAACGAAGTTGCATTTTTTCAGCTATAACTCTTCTATAATTTTAAATAAACCTTCAGAAATCATTTTAATGTGCTGATTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14700
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023571 Nonsense 409 475 12 13
Genomic Location (Zv9):
Chromosome 19 (position 10923793)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10382332
GRCz11 19 10301257
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGGAGTACGAGGAGATCGTGGAGGACGTCAAAGAGGAGTGCTCTAAATA[T/A]GGCCAGGTCAAGAGCATAGARATTCCCAGACCCGTCGATGGCCTTGATAW
Long Flanking Sequence:
TGGGCACAAAAATCTATGTTTCGAGGTATAAAAAATTTGCATTTAATTATTTAAACAGAAAAATTATACTTATTTAGAATTTTTGTCTTGTTTCTAGTTCAAATAACTACATTTCAAAGCAAAACTCCCCAGAAAACCATCAAATAGTGCTATTTTAACCATCTTGAGAAACTATTCATATCGCAATATTAATTGTAGAAAAATAAAATATTGCCGATTGTAATATATATCAGATTTTTCCCAATATAGCACAGCCCCAATTCTAATCATCCTTAAATTGTCTGTATTTCCCCTCTTTTCATTATCCATCTGTAGACGAGTATAAACGAGACTCCAGTGACGTTGCAAGTGCCTGGCCTCACATCCAACCCCATGATCCAGATGGGCGGTATTCCCACTGAGGTCCTGTGTCTGATGAACATGGTGGCTCCAGAGGAGCTTATCGACGATGAGGAGTACGAGGAGATCGTGGAGGACGTCAAAGAGGAGTGCTCTAAATA[T/A]GGCCAGGTCAAGAGCATAGAAATTCCCAGACCCGTCGATGGCCTTGATATACCTGGAACTGGCAAGGTAAGCCTTACCAAAGCAGCTCGAGTGGGCTGCAAACTTTTTTTTTTTAACACTTTTATTGTTTCAGAAAAATGTGATACATACATACTGTATTAGTAACCAAATACCAGTCAAAGAACACCTGCCCCGTCCTGACATTCAAATAAAAAAAATAATTTAAAAAATGCATTCTCATGCGAGGAAATAATACATAAACAAATAAATAGAAAATAAAGATTAACTAAAATAAGATAAAATAATAATAAAAATTAAAAAGGGCAATTTTGTTAAAAATAAAAAATATATAAAAAATAAATACCATTAAAAAAATTGACATTTCAACATATACATTCTAGTGAAAGTGAAAAGTATATTAAAGTTAGTCATTACAAACAGTGAATTTTAACAGTCACATTGTTTGGGATTACTAAACGGTCAGTCCACTCTTATTTAAA
Associated Phenotype:
Not determined