Busch Lab

ZMP

clock

Ensembl ID:
ENSDARG00000011703
ZFIN ID:
ZDB-GENE-990630-14
Description:
circadian locomoter output cycles protein kaput [Source:RefSeq peptide;Acc:NP_571032]
Human Orthologue:
CLOCK
Human Description:
clock homolog (mouse) [Source:HGNC Symbol;Acc:2082]
Mouse Orthologue:
Clock
Mouse Description:
circadian locomotor output cycles kaput Gene [Source:MGI Symbol;Acc:MGI:99698]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa39276 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14713 Essential Splice Site Available for shipment Available now
sa23683 Nonsense Available for shipment Available now
sa17257 Nonsense Available for shipment Available now
sa37017 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39276
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025575 Essential Splice Site 27 892 2 20
Genomic Location (Zv9):
Chromosome 20 (position 22216712)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 22244879
GRCz11 20 22144552
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTATCTTTGATGGGTTGATGGAAGAAGATGAGAAGGACAAAGCAAAAAGG[T/C]GATTATACAAGTAAAACTTTATGATTTTAATTGCTCACAGCGATATCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14713
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025575 Essential Splice Site 76 892 3 20
Genomic Location (Zv9):
Chromosome 20 (position 22217335)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 22245502
GRCz11 20 22145175
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAGTYTACCATCCTACAGAAGAGCATCGACTTCCTGCGCAAGCACAAAG[G/A]TTACTCTTGTTGCATAACAATTATTGTTTATYATTTGGAAAATTTAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23683
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025575 Nonsense 203 892 7 20
Genomic Location (Zv9):
Chromosome 20 (position 22222543)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 22250710
GRCz11 20 22150383
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACATGCTCCGGGGCACCATCGACCCCAAAGAGCCGCCCGTTTATGAATA[T/A]GTCAAGTTCATCGGAAACTTTAAGTCCCTCAACACTGGTGAGTGTCAGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29345
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025575 Essential Splice Site 216 892 8 20
Genomic Location (Zv9):
Chromosome 20 (position 22226178)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 22254345
GRCz11 20 22154018
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCCCTAAAAAGCCTTCATTTCTAAAGATGTGTGTCTTGTTTTTCTCTGC[A/G]GTGCCTAACTCAACACGAAACGGCTTTGAGGGAGTGATCCAGCGATCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17257
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025575 Nonsense 414 892 13 20
Genomic Location (Zv9):
Chromosome 20 (position 22232759)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 22260926
GRCz11 20 22160599
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGGCTCCGAGTCTCAGTTGAACACCWCCAGCTTGAAGGAGGCSCTAGAG[C/T]GATTCGATCACAGCCGCACACCCTCAGCCTCKTCACGCAGCTCCCGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37017
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025575 Splice Site, Nonsense 476 892 15 20
Genomic Location (Zv9):
Chromosome 20 (position 22235745)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 22263912
GRCz11 20 22163585
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTAGTTTGTCTCTGTTCAGGCTGTTTACTCTTGTGTTTGTGTGTTCAGT[C/A]GATGAGTTCTCAGACCACAGGACAGACGATGGGAACATCTCTTGTGTCTC
Associated Phenotype:
Not determined