Busch Lab

ZMP

si:ch211-106g4.2

Ensembl ID:
ENSDARG00000011672
ZFIN ID:
ZDB-GENE-081105-78
Description:
semaphorin-3B [Source:RefSeq peptide;Acc:NP_001121818]
Mouse Orthologue:
Sema3b
Mouse Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B Gene [Source:

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa2422 Nonsense F2 line generated Not yet available
sa41225 Nonsense Mutation detected in F1 DNA Not yet available
sa12992 Nonsense Available for shipment Available now
sa41224 Nonsense Mutation detected in F1 DNA Not yet available
sa21310 Nonsense Available for shipment Available now
sa6101 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa2422
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015985 Nonsense 35 781 1 18
ENSDART00000027301 Nonsense 35 775 1 17
ENSDART00000062608 None None 272 None 8
Genomic Location (Zv9):
Chromosome 8 (position 27461919)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26589837
GRCz11 8 26608976
KASP Assay ID:
554-2700.1 (used for ordering genotyping assays)
KASP Sequence:
GCTTCATTGAGCGGAAGCTCACAATCCTCACCCCGGATGAAACTGTCTYA[T/G]AAAGGTAGTGCACTATATCWAATSCCTGTTATTTTATTCYCAGGTTCAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18919
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015985 Essential Splice Site 36 781 1 18
ENSDART00000027301 Essential Splice Site 36 775 1 17
ENSDART00000062608 None None 272 None 8
Genomic Location (Zv9):
Chromosome 8 (position 27461914)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26589832
GRCz11 8 26608971
KASP Assay ID:
2260-0691.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGAGCGGAAGCTCACAATCCTCACCCCGGATGAAACTGTCTTATAAAG[G/T]TAGTGCACTATATCTAATGCCTGTTATTTTATTCTCAGGTTCAGTTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41225
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015985 Nonsense 116 781 4 18
ENSDART00000027301 Nonsense 116 775 4 17
ENSDART00000062608 None None 272 None 8
Genomic Location (Zv9):
Chromosome 8 (position 27448664)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26576582
GRCz11 8 26595721
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTGTGCATGTGTGTGTGTGTGTGTGTTGCAGACGGATTGCGTAAACTA[T/A]GTGAAAGTGCTACACCACTATAATCGAACTCACCTATACGCCTGTGGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12992
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015985 Nonsense 123 781 4 18
ENSDART00000027301 Nonsense 123 775 4 17
ENSDART00000062608 None None 272 None 8
Genomic Location (Zv9):
Chromosome 8 (position 27448643)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26576561
GRCz11 8 26595700
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGTGTTGCAGACGGATTGCGTRAACTAYGTRAAAGTGCTACACCACTA[T/G]AATCGAACTCACCTRTAYGCCTGTGGTACGGRGGCTTTCCACCCCACCYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41224
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015985 Nonsense 353 781 10 18
ENSDART00000027301 Nonsense 353 775 10 17
ENSDART00000062608 None None 272 None 8
Genomic Location (Zv9):
Chromosome 8 (position 27446260)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26574178
GRCz11 8 26593317
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCTGCAGTGTGTCTCTATACTATGAACGACATTCGCCGAGCATTTTTA[G/T]GACCTTTTGCCCATAAAGAGGGACCCAATTACCAGTGGATTCCATTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21310
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015985 Nonsense 483 781 12 18
ENSDART00000027301 Nonsense 482 775 12 17
ENSDART00000062608 Nonsense 96 272 2 8
Genomic Location (Zv9):
Chromosome 8 (position 27444098)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26572016
GRCz11 8 26591155
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGAAGCTGGAGCAACACTGAGCTGCTGCTGGAGGAGCTGCACGTCTTT[A/T]AGGTGAACACAAAAATGTGTGGCTTTTATTTAGAGGGATAACATAAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6101
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015985 Nonsense 519 781 14 18
ENSDART00000027301 Nonsense 518 775 14 17
ENSDART00000062608 Nonsense 132 272 4 8
Genomic Location (Zv9):
Chromosome 8 (position 27442352)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26570270
GRCz11 8 26589409
KASP Assay ID:
554-3925.1 (used for ordering genotyping assays)
KASP Sequence:
GGCTCAGACACAGGTGTTGTCCAGGTGCCTCTGCACCGCTGCAGTWTGTA[C/A]GGTAAAGCYTGTGCCGAGTGCTGTTTGGCTCGAGATCCGTACTGCGCCTG
Associated Phenotype:
Not determined