Busch Lab

ZMP

fam116b

Ensembl ID:
ENSDARG00000011605
ZFIN ID:
ZDB-GENE-030131-9382
Description:
family with sequence similarity 116, member B [Source:RefSeq peptide;Acc:NP_956359]
Human Orthologue:
FAM116B
Human Description:
family with sequence similarity 116, member B [Source:HGNC Symbol;Acc:32690]
Mouse Orthologue:
Fam116b
Mouse Description:
family with sequence similarity 116, member B Gene [Source:MGI Symbol;Acc:MGI:1916690]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa20263 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8165
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024647 Essential Splice Site 64 575 2 20
Genomic Location (Zv9):
Chromosome 4 (position 19015575)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20092181
GRCz11 4 20081157
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTCCTCAGCTTGTTTACCCTCATGATGTCAAACTCACAGAAAAGGAGG[T/C]AAGTGCRMATTAATTAAAATCATTTACCTTTTTTTNATTACCAGCTACTG
Long Flanking Sequence:
TCATTCCTCGCCGCGCGAGGGCGCTATTCAACCTCGGAGATTACTAAACGATGAGCGAGGACGTGACCATTCACAAACACAAGCGGATCTCAAATGGCTCTTTAAGTCACGATGGACCCGTTTGACAGCTCCGAGTCGTTGGAAGGCCCATCAAAAGCGGTGGCGACAACTGCAGAGTTTTCAGAGCCGTGGTCGCGCTTCTCCGCTTGGCTCGAGTGTGTGTGCGTGGTTACCTTCGACCTCGAGCTCGGACAAGCCATAGAGGTACACAATGATGTGCACGCACGCCTAACATCTGTTTGTCTATTTCTTTACTACATTTAAAACCCTTAAGAGGCTACATTTACATTGCCATAAGATTCAGTGAAATAGCACAACATCATAATGGCAATACTCTCATTGTAACCACAGCAACAGCAGCATCACTGTGTGTGAGTAACATTCTTCATGTTGTCCTCAGCTTGTTTACCCTCATGATGTCAAACTCACAGAAAAGGAGG[T/C]AAGTGCAAATTAATTAAAATCATTTACCTTTTTTTTATTACCAGCTACTGCATTATACATCTGTAAAAGGTGTTACAAATACAAATTTCCTTGTAAAATGCCTCAAAACTGTTTGCTTTTTATGCTTTTCAGAAAACCAGCATCTGTTACTTGTCGTTTCCTGACTCATACTCAGGTAATGTGCTGGCACAGACTGATTTCATCAGTGCTATCATGATAAACTGCTGAAATTTGAGTATTGTGGCTCAGTCACATGAGTGCATGTCTATCCCAGGATGCCTCGGGGACACTCAGTTCAGCTTCAGACTGCGGCAATCTGTAGGCCGCAGTAGTTCCTGGTTTGGACAAGAAGATGTGTACAACAGGGATGCCCCTGTGACCCTGCAGGTTAGAAATGGACTTTTGTTTTCTAGGCAAATGTTTATACTAAGGACTTGGGGCATTTTTGCAAGGTAAATCAATAGGATGTGATGTTTACACACTCAGTGGCTACTCTTTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26288
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024647 Essential Splice Site 205 575 7 20
Genomic Location (Zv9):
Chromosome 4 (position 19013261)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20089867
GRCz11 4 20078843
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTTCCAGGACAGACCCTCAACTTACCTGTGATGGGTGTGGTGATGCAG[G/A]TAAGAATGTTAAAGATGAAAAATATAATTGTTCTTTTGGTTAAAAGCCAT
Long Flanking Sequence:
CTGCAACCCTTGGCATCCTTAGTATTTGTTATTACTATTGTGGGAGTCAATGGTTGCCAATTTCAAACATTCTTTAAAACGTCTTCTCATAAAGAAACTCATAAAGGTTTGGAACCACCTGAGTGTAAATAAAACTTTTCAGTGCATTTTTTATCCCTTTAAGTATCTTAACCAAAATAATTGTTTTCTTTTTCTCAGTATAGCATATTTATTTTGTTTTGGTGGTCTGATATTAATTGAACTTGTATATAATTATATTTGCATAACTAGGTTACAAAAAGCCACATTTAATTGACTGCAATTTATCACTGAAATAAATTACAGTTTAGAATATATTGAATTAGAAATAGTTGTTTTAATTGTAATATTTTTTTCACAGTGTTACTGTTTTAAGATGTCTTATGGGTTGATGTGTTTCAGTCTGTAATGAGATTGACCAATGGCCAGCACCAGTTCCAGGACAGACCCTCAACTTACCTGTGATGGGTGTGGTGATGCAG[G/A]TAAGAATGTTAAAGATGAAAAATATAATTGTTCTTTTGGTTAAAAGCCATTTATTACATGATATTTTGGAAAAAATAAAATAACTCACCCCTTCGCCAGGAGTTTGACTGGCAAGCAATCTGACCATTTAATAAAAATGCTCAAATTGACTATGAAAGGACCATGGCTGGCAGTAAATGATTATTAATATGATATTTTTCATCCAATTTATCAAATGGTTTTGAATCTACAGATCAGAATACCTTCAAAAGTTGAAACAGCAGAAGGAAGCCCCGTAAAACAACAACAAACAGAGGTGCACACCACATTTTTTTAAATACAACAATTATGCTCACATATGCTTTTATTTGTACATATGGTTAACATCTGGTTTCATGATTGCAGAATCTGCTCCCGGCTCCCACAGTTCTTCCATCAGTTCATGAGCTGGATCTCTTTAAGTGAGTATTGCACTGTTCTGCAATTACGAAGCCATCTGTTGATTTTACAGCCGTCACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20263
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024647 Essential Splice Site 318 575 11 20
Genomic Location (Zv9):
Chromosome 4 (position 19011765)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20088371
GRCz11 4 20077347
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCATTCATGACAGTGAATTCAAGGAATACACCACCAGGACTCAGGCTCC[G/A]TAAGCAAAAAAGCACTACACTTTACAGTCTTTCTCTAAAGCGATCATTCA
Long Flanking Sequence:
TTTAAATCCTTAAAGCAAGACTTTTGCAACTGGCCACAATTAAAATGAAGTAATATGTATGTAAATAGTAGGTAGTTTATATCCTATTTTTACAAAGAATTAAATCTACAAATGTGATTTATTATATTGTACATAAAAATATATTTTAAAATCGTAGTTTATTCTAATTAAAGTTACAACTTGAATGTTTCAAGAAACCTTTTTGAAAATAAAATGGCAAAATATGAGTGAGAGTAATGTTCCATGATGATTCAGCATAACAGATTTATGAAAAACATGAAACAACATATTTATTTTGATGTGTACTTCTTGATATATTTAGAATAAGTGATGAAACCCCCTTTTATTCCTTGATCCACATATTTTATATATTACTCATATTCCTCTTATGTTGACTGTTTCAGCTCAATTGACCCACTGCACTACTTTGGTGATTACCGACCATACTTTACCATTCATGACAGTGAATTCAAGGAATACACCACCAGGACTCAGGCTCC[G/A]TAAGCAAAAAAGCACTACACTTTACAGTCTTTCTCTAAAGCGATCATTCACCCAAAAAAGAAAATTCTGATTCACCTTCAGGTTATATCAAATTCTTTAAAAATATGTTTTTGAAGTATGACTCTATTCCAGTCCCGTTTTGGAATGATAATTAAAGTGAATAATTGAAGAATTTATGACTTGAATGGTCTTGAAAACTGCATCTAGGATATTCTTCAAATTTGCCTTTTAATTTTTGGGTGAAACCTTGACTAAATCTGTTTTCTACTTTCAGACCCAATGTTATATTGGGTGTCACAAACCCTTTCTTTATAAAGACCTTTCAGAGCTGGCCTCACATCATTCGCCTTGGAGAACTGAAGATGTCAGGTAATTGTTTCTAGTTCTTACATCACTCCTGATTAATAGGTTTTTGCATCAAAGATATCTGAAATCTGATTTTCTCTGCAGGTGATTTGCCAAAGCAAGTAAAGATCAAGAAATTGGCAAAGTTAAAAACA
Associated Phenotype:
Not determined