Busch Lab

ZMP

epha4b

Ensembl ID:
ENSDARG00000011600
ZFIN ID:
ZDB-GENE-030826-6
Description:
eph receptor A4b [Source:RefSeq peptide;Acc:NP_705944]
Human Orthologue:
EPHA4
Human Description:
EPH receptor A4 [Source:HGNC Symbol;Acc:3388]
Mouse Orthologue:
Epha4
Mouse Description:
Eph receptor A4 Gene [Source:MGI Symbol;Acc:MGI:98277]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa13595 Splice Site, Nonsense Available for shipment Available now
sa39899 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa13595
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007709 Splice Site, Nonsense 661 923 11 15
ENSDART00000037292 Splice Site, Nonsense 714 976 15 19
Genomic Location (Zv9):
Chromosome 2 (position 40252987)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 40646177
GRCz11 2 40500411
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATAATATAATTAGTATTGCTCACACATTTGTCTTGTCTTTTCTCTTGCAG[A/T]AGCATGATGGGCAGTTCACAGTYATTCAGCTGGTGGGCATGATGCGTGGC
Long Flanking Sequence:
TATAGTTTGAAATGTATGCTCTTCTTCTCCCCTAAGGGCTTATTATCTGTTGCCATCTTGTGGTGGAACGTCAACCATCTTTGTTCTGCTTAATGGCAGGCTGATGGCTGCTGATGCGCTGAATGTCTGAAATTAAACATATTTTAAATATGCACTATTTTATAAATAAACTGCATAAATGCAATCTAAACAACTATATTCTCACAAATGTCTCAAAAGTACATTATGTTGTCCAATAGCTGCAATATTTGTCAAACTGTAGTGAGTTTATTGATCTGATGTCACTCTATGTGGGCGGAGTAATACACAATAGTGAAGAGGGTGTATGAGTGCTGTTATAGCACGGCTATCAGCCAATCAAATTCAAGAACCAGAAAGAACTACTGTCATATAATAAAATAAATTATAATATAATATAATATAATATAATATAATATAATATAATATAATATAATATAATTAGTATTGCTCACACATTTGTCTTGTCTTTTCTCTTGCAG[A/T]AGCATGATGGGCAGTTCACAGTCATTCAGCTGGTGGGCATGATGCGTGGCATCGCTTCAGGAATGAAATATCTGTCTGATATGAGCTACGTCCACCGTGATCTGGCAGCTCGCAACATCTTGGTCAACAGTAACCTGGTGTGCAAAGTGTCTGACTTTGGCCTGTCCAGAGTGCTGGAGGATGATCCTGAAGCTGCGTATACAACACGGGTAAAGCATCTTTTCTTTATTAATGTTGTAGATTTAGCATCTATTTTTACAGCTTGGATCGAAGGTTGCATATGTAACCATCGTTCCCTGAAGGAGAGAATAGAGACATTAAGTCAGGAATTCAATTAAATTTAAGCTTATTGGTATTGTATTTTGCTTTTCACTTTAATTATTGTTCCAAAAGCATCTTTGCAAAAAGTGCATGTTAGTACATCACCGTCAAATCAGAAAGTTAAGGTCATGTATATAGGGTGGAAAGTATATTAACAGTGCTCAGCATTTATGTGTACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5163
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007709 Nonsense 738 923 12 15
ENSDART00000037292 Nonsense 791 976 16 19
Genomic Location (Zv9):
Chromosome 2 (position 40257208)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 40650398
GRCz11 2 40504632
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATACTTTCTTTTATCTTTTCTTATTCAGGGTGGAAAAATCCCCATTCGAT[G/A]GACAGCCCCAGAGGCCATCGCGTACAGAAAGTTCACCTCAGCGAGTGACG
Long Flanking Sequence:
TTCACCTCATTGACAATGTTATCGACAGTAAATACTTGAGATTCATATTTTTTATTATTGGTTTTAAATTTTAAGATTGAAAACGTTTGAGAGAAAAAAAATAAGAATAAAGGGAAACAATTAAATGAAAACTCTGTCATTACATTTAATGAAAGACTAAATTTATACATGTTATGTGGTCATCACACACTGTAAAAAAGGCCGGGTTCTGCACAATCCATTTGTGTTGGGACAACATGAAGGAATTTAGTTAACTTATTAGTTTTTACAAATTTAAGTGAATTGAACATTAAACAATTAAGTTGTCGTTGTTTCATCTCATTTTAAATAAGTAGCTTAAACAAGCGACAACAAAAAAATTTATAAAATTGAGTGTACATTCTGTAACAAAACCTGTTAATCTGAATAAAATCAACTCATATGACATAATAGTTCCTAACAGTTAAAGCAATACTTTCTTTTATCTTTTCTTATTCAGGGTGGAAAAATCCCCATTCGAT[G/A]GACAGCCCCAGAGGCCATCGCGTACAGAAAGTTCACCTCAGCGAGTGACGTGTGGAGTTACGGCATCGTCATGTGGGAGGTGATTTCATACGGAGAACGGCCATATTGGGAGATGTCTAATCAAGACGTAAGTGTCCTTGACAAAACCGCAAACACACACGTCCTCGCGTGGATTGTTTCAATTGAAATCTGCTCCACTAATATCTTGGGTAATATCATTTGCACTGAAAACCTCTTGAGGGGAGCAGAGTCTCTGAACTGTGTGTCCTTGCAAACGAGTAAAATCCATACTGAAAACCTGCTTGAATGACAATGGTTTTTAGGAGCCTCATAAACGAGAGCTGTCCAGCTGCTCCTGTCTTTAAAACAAGCCAGTTAAACACACTCCATCCCTCGCTGCTGTATTATGCTAACGGTTTCTGACTTTCCCCCTTATTACCATCAGAGGAAATGTCAGAGAAATCTTGAGGACCTTCAGGGCACCGCTATAATGATTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39899
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007709 Nonsense 813 923 13 15
ENSDART00000037292 Nonsense 866 976 17 19
Genomic Location (Zv9):
Chromosome 2 (position 40259640)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 40652830
GRCz11 2 40507064
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGCCCCGTGGTCCTTCATCAGCTCATGCTGGACTGCTGGGAGAAAAGC[A/T]GAAGTGAACGGCCCAAATTCGGGCAGATCGTCAACACTCTTGACAAACTT
Long Flanking Sequence:
TATTAAAACTATTATGTTTAGAAATGTGTTAAAAAAAATCCTCTCTCTGTTAAACAGAAATTGGGGAAAAAACCAGGGGGGCTAATAATTCTGACTTTATATGTATATGAAACTGTATATGAAAATAAATATTTATGTAAAGTTAAATATTAAATGGAAAGTCAACTAATTAAATTTTGCTGTCATTTAGTCACCAACATTATCCCAAACCTCTATGACTTTCTTTATTATGCAGAACACAAAAGATATTTTGAAAAATGTTGGTAATTGTTTTAAATCCCCTTGATTAGTTGGCAGTAAATGGAAATCAATAGAAACCCAAACTGTAGAAAGTAAGAAACACGTACCAACATGAATGAAGCTTTTGTTCTTTGCATGTTTTGACTCCTGTGTCTTTGTTGTAGGTGATTAAAGCTATAGATGAGGGTTACAGGCTTCCCGCCCCAATGGACTGCCCCGTGGTCCTTCATCAGCTCATGCTGGACTGCTGGGAGAAAAGC[A/T]GAAGTGAACGGCCCAAATTCGGGCAGATCGTCAACACTCTTGACAAACTTATCCGCAACCCCAACAGTCTGAAGGAGCTCGCTAACAGCTCAGTTTGGTGAGAAACTTAATTTCATTTAAATCCAGCTGATGTTTAAGCACAGCTAAAGGCATTGGACAATATGCTTATAACTGTGTTTATGGCGTTTTTTGGCCCTAGGTTAAGTCAGTTGGAGTCTGGTTGAAGTCAAAATTGACAATAAATGTTCTTTGTCACCTCACAATGTTTTTCTTGTGGTGAACAGTTAATCTGTGCCCAATTAATGTTTCTGTTGACATCCGTGTAATAACAGACAGAATGTATATGAAAAACTATGATTTCTGTTTCAAATTAAGGCTTCATATCCAAAATGCATAACAGTTTCCACAAAACAAAGTGACATGTCAGAGTAATTTTAACTTAGATAGTAAAAAAAAAAATACTGACCATTGTTTGATTTTTCTTTATTGTTTTCCCTTAT
Associated Phenotype:
Not determined