Busch Lab

ZMP

smarcb1b

Ensembl ID:
ENSDARG00000011594
ZFIN ID:
ZDB-GENE-991008-16
Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1b
Human Orthologue:
SMARCB1
Human Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 [S
Mouse Orthologue:
Smarcb1
Mouse Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 Ge

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29553
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011318 Essential Splice Site 191 370 None 10
ENSDART00000062190 Essential Splice Site 203 382 None 10
ENSDART00000138207 Essential Splice Site 157 210 None 6
ENSDART00000138626 Essential Splice Site 131 283 None 8
ENSDART00000145454 Essential Splice Site 191 370 None 10

The following transcripts of ENSDARG00000011594 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 13810419)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 15511374
GRCz11 21 15607351
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGATTGATGGACAGAAGCTCAGAGATGCCTTCACCTGGAACATGAACGG[T/G]AGACAAAATAGATACTTTATATGCGCATTATTTTAATGACATTTAGCAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4163
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011318 Nonsense 312 370 8 10
ENSDART00000062190 None None 382 None 10
ENSDART00000138207 None None 210 None 6
ENSDART00000138626 None None 283 None 8
ENSDART00000145454 None None 370 None 10

The following transcripts of ENSDARG00000011594 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 13818726)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 15519681
GRCz11 21 15615658
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTTTATGTTGAAAGAGATGCTGTACAAATCTAACTTCTTGTGGCTCCTA[T/A]TTCCTGCAGTGAGAACCCGTTACCAACTGTAGAGATCGCCATTCGCAACA
Associated Phenotype:
Not determined