Busch Lab

ZMP

sfpq

Ensembl ID:
ENSDARG00000011564
ZFIN ID:
ZDB-GENE-040426-2452
Description:
splicing factor, proline- and glutamine-rich [Source:RefSeq peptide;Acc:NP_998443]
Human Orthologue:
SFPQ
Human Description:
splicing factor proline/glutamine-rich [Source:HGNC Symbol;Acc:10774]
Mouse Orthologue:
Sfpq
Mouse Description:
splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated) Gene [Sourc

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa29250 Nonsense Mutation detected in F1 DNA Not yet available
sa667 Nonsense F2 line generated Not yet available
sa36893 Nonsense Mutation detected in F1 DNA Not yet available
sa17716 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa29250
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017359 Nonsense 197 638 1 10

The following transcripts of ENSDARG00000011564 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 40987092)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 40439630
GRCz11 19 40026750
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCCTTGAAGCAAGAGCAGACGCCAGCACCAACACCCCCACCAGCACAA[C/T]AACAGCAGCAACAGCAACAACAACAAAAACAGACTCCCGCAAACGAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa667
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017359 Nonsense 407 638 4 10

The following transcripts of ENSDARG00000011564 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 40988392)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 40440930
GRCz11 19 40028050
KASP Assay ID:
554-0575.1 (used for ordering genotyping assays)
KASP Sequence:
AATTGTTGGAGCAGTATGATGACGAGGACGGTTTGCCCGAGAAGCTTGCA[C/T]AGAAAAACCCCAGTTATCAAAAGTAGGTTCCAAATGTTTGATCACATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36893
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017359 Nonsense 529 638 7 10

The following transcripts of ENSDARG00000011564 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 40991501)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 40444039
GRCz11 19 40031159
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACGTCGTAGGAGAGAGGAGGAGATGATGCGGCAGAGGGAAATCGAAGAA[C/T]AATTGAGGCGCAAACGCGAGGAATCTTACAGAATGAACAACTTCATGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17716
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017359 Essential Splice Site 599 638 9 10

The following transcripts of ENSDARG00000011564 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 40993668)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 40446206
GRCz11 19 40033326
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCAGGGACTAAGTGGATCAACACAAGGGGGCCTAGCGTCCAACGAAATG[G/A]TAATGTTTTCATGAGTTKAAAGCATGAGTGAATGTGAGCNNGTGTGTGTG
Associated Phenotype:
Not determined