Busch Lab

ZMP

SCUBE3

Ensembl ID:
ENSDARG00000011490
Description:
signal peptide, CUB domain, EGF-like 3 [Source:HGNC Symbol;Acc:13655]
Human Orthologue:
SCUBE3
Human Description:
signal peptide, CUB domain, EGF-like 3 [Source:HGNC Symbol;Acc:13655]
Mouse Orthologue:
Scube3
Mouse Description:
signal peptide, CUB domain, EGF-like 3 Gene [Source:MGI Symbol;Acc:MGI:3045253]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa31094 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44045 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa31095 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44044 Nonsense Mutation detected in F1 DNA Not yet available
sa37783 Nonsense Mutation detected in F1 DNA Not yet available
sa39426 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44043 Nonsense Mutation detected in F1 DNA Not yet available
sa37782 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10452 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31094
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102879 Essential Splice Site 39 829 1 19
ENSDART00000102879 Essential Splice Site 39 829 1 19
ENSDART00000102879 Essential Splice Site 39 829 1 19
Genomic Location (Zv9):
Chromosome 23 (position 41702042)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41536257
GRCz11 23 41431750
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAATGCAGACCAGGATTTCAGCTCACCAAGAACAATCGAGACTGTAAATG[T/G]GAGTAATCAATCATGTTAATTACACACTCTCCACAATGGCGAGGAAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44045
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102879 Essential Splice Site 39 829 1 19
ENSDART00000102879 Essential Splice Site 39 829 1 19
ENSDART00000102879 Essential Splice Site 39 829 1 19
Genomic Location (Zv9):
Chromosome 23 (position 41702042)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41536257
GRCz11 23 41431750
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAATGCAGACCAGGATTTCAGCTCACCAAGAACAATCGAGACTGTAAATG[T/G]GAGTAATCAATCATGTTAATTACACACTCTCCACAATGGCGAGGAAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31095
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102879 Essential Splice Site 39 829 1 19
ENSDART00000102879 Essential Splice Site 39 829 1 19
ENSDART00000102879 Essential Splice Site 39 829 1 19
Genomic Location (Zv9):
Chromosome 23 (position 41702042)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41536257
GRCz11 23 41431750
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAATGCAGACCAGGATTTCAGCTCACCAAGAACAATCGAGACTGTAAATG[T/G]GAGTAATCAATCATGTTAATTACACACTCTCCACAATGGCGAGGAAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44044
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102879 Nonsense 62 829 2 19
Genomic Location (Zv9):
Chromosome 23 (position 41700184)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41534399
GRCz11 23 41429892
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCGGCTGTCAGCACATCTGTGAGGAAACGGATCATGGGCCCAAATGCT[C/A]GTGTCACATGAAGTTTGCTCTTCACTCAGATGGAAAGACCTGTGTAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37783
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102879 Nonsense 123 829 4 19
Genomic Location (Zv9):
Chromosome 23 (position 41651348)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41485563
GRCz11 23 41381056
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTGCTCAGTCTCTCTCTCTCTCTCTCTGATTACAGACATTGATGAATG[T/A]CGCATGAACAACGGTGGCTGTGATCACGTTTGCAGAAACACCGTCGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39426
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102879 Essential Splice Site 404 829 11 19
Genomic Location (Zv9):
Chromosome 23 (position 41608575)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41441290
GRCz11 23 41333254
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGGAAACGCGCTGTGTGAAAGTTCTGGCGTTCATCTATTTTTCATGTTC[A/T]GGGAACTGCAACATGATGTGTCAACGGCAGCACATGGAGCAGCAGATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44043
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102879 Nonsense 410 829 11 19
Genomic Location (Zv9):
Chromosome 23 (position 41608554)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41441269
GRCz11 23 41333233
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCTGGCGTTCATCTATTTTTCATGTTCAGGGAACTGCAACATGATGTG[T/A]CAACGGCAGCACATGGAGCAGCAGATGAAGACGTACATTAAAACCCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37782
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102879 Essential Splice Site 586 829 15 19
Genomic Location (Zv9):
Chromosome 23 (position 41596368)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41429083
GRCz11 23 41321047
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTAGACTACTGTCTATGTGTGTGTGTGTGTGTGTGTATAGTGTTGTGTTC[T/A]CCAGGTCATTATTATAACACATCAGTTCATCGGTGTATCCGCTGTCCTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8026
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102879 Nonsense 611 829 15 19
Genomic Location (Zv9):
Chromosome 23 (position 41596292)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41429007
GRCz11 23 41320971
KASP Assay ID:
2261-8200.1 (used for ordering genotyping assays)
KASP Sequence:
TTCATCGGTGTATCCGCTGTCCTCATGGAACCTACCAGGCTGAATTCAGA[C/T]AGAACTACTGCWTYTCCTGTCCTGGAAACACCACCACAGACTTTGACGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10452
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102879 Essential Splice Site 701 829 16 19
Genomic Location (Zv9):
Chromosome 23 (position 41595489)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41428204
GRCz11 23 41320168
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTCCCGTCTGAGGATGAGTGTGGAGATGTGCTGGTCATGAGGAARAACT[G/T]TACGTCTTTCTGTTTTTCCACAGTTTASCATTATCRACCTCCACYTTTAC
Associated Phenotype:
Not determined