Busch Lab

ZMP

sirt2

Ensembl ID:
ENSDARG00000011488
ZFIN ID:
ZDB-GENE-030131-1028
Description:
NAD-dependent deacetylase sirtuin-2 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVK3]
Human Orthologue:
SIRT2
Human Description:
sirtuin 2 [Source:HGNC Symbol;Acc:10886]
Mouse Orthologue:
Sirt2
Mouse Description:
sirtuin 2 (silent mating type information regulation 2, homolog) 2 (S. cerevisiae) Gene [Source:MGI

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa13413 Nonsense Available for shipment Available now
sa9082 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa13413
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013278 Nonsense 53 379 4 16
Genomic Location (Zv9):
Chromosome 15 (position 6674972)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 6792263
GRCz11 15 6789356
KASP Assay ID:
2260-8145.1 (used for ordering genotyping assays)
KASP Sequence:
CAGTGGATTTTTTGCGCAGTCTTTTCTCGCGAACACTTGGCCYTAGTCCT[G/T]GAGATAAAGTCTTGGATGAGTTAACCCTGGACTCAGTTGCTCGCTACATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9082
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013278 Nonsense 102 379 6 16
Genomic Location (Zv9):
Chromosome 15 (position 6677194)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 6794485
GRCz11 15 6791578
KASP Assay ID:
2260-8146.1 (used for ordering genotyping assays)
KASP Sequence:
TCTTTAGCTGCAGGAATCCCAGATTTCCGCTCTCCTGGCACGGGCTTATA[T/A]GCAAATCTGCAGAAGTACAACCTGCCTTACCCAGAGGCCATCTTTCAGAT
Associated Phenotype:
Not determined