Busch Lab

ZMP

si:dkey-12h9.13

Ensembl ID:
ENSDARG00000011445
ZFIN ID:
ZDB-GENE-041001-151
Description:
hypothetical protein LOC569908 [Source:RefSeq peptide;Acc:NP_001038658]
Human Orthologue:
C14orf43
Human Description:
chromosome 14 open reading frame 43 [Source:HGNC Symbol;Acc:19853]
Mouse Orthologue:
C130039O16Rik
Mouse Description:
RIKEN cDNA C130039O16 gene Gene [Source:MGI Symbol;Acc:MGI:2685106]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa17680 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4106
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024821 Nonsense 295 1016 1 12
ENSDART00000128908 None None 224 None 2
ENSDART00000142611 Nonsense 295 976 2 13
Genomic Location (Zv9):
Chromosome 20 (position 25928048)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25999351
GRCz11 20 25898441
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCTGCATCAACTGCAACAGCAATACCATCAGCAGCAGAAAATGCAGCAA[C/T]AGATACACCAGCAACTACAGCAACAGACACAAGGGTTTCAACACCTAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17680
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024821 Nonsense 433 1016 1 12
ENSDART00000128908 None None 224 None 2
ENSDART00000142611 Nonsense 433 976 2 13
Genomic Location (Zv9):
Chromosome 20 (position 25927634)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25998937
GRCz11 20 25898027
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCACAGTGGGGGTCATCCAGAGYACTCWGAGAAGACGAAGAGCCTCAAAA[G/T]AGATCAACCTTGAGACTCTTGCWCAGCAGGCTTCAGAAATGGAATTTTTG
Associated Phenotype:
Not determined