Busch Lab

ZMP

ryr1a

Ensembl ID:
ENSDARG00000011422
ZFIN ID:
ZDB-GENE-020108-2
Description:
Ryanodine receptor 1a [Source:UniProtKB/TrEMBL;Acc:A7M793]
Human Orthologue:
RYR1
Human Description:
ryanodine receptor 1 (skeletal) [Source:HGNC Symbol;Acc:10483]
Mouse Orthologue:
Ryr1
Mouse Description:
ryanodine receptor 1, skeletal muscle Gene [Source:MGI Symbol;Acc:MGI:99659]

Alleles

There are 19 alleles of this gene:

Allele Name Consequence Status Availability
sa41692 Nonsense Mutation detected in F1 DNA Not yet available
sa21768 Nonsense Available for shipment Available now
sa41693 Nonsense Mutation detected in F1 DNA Not yet available
sa21769 Essential Splice Site Available for shipment Available now
sa34941 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24879 Nonsense Mutation detected in F1 DNA Not yet available
sa16264 Nonsense Available for shipment Available now
sa45414 Nonsense Mutation detected in F1 DNA Not yet available
sa12583 Nonsense Available for shipment Available now
sa1535 Nonsense F2 line generated Not yet available
sa17197 Nonsense Available for shipment Available now
sa34942 Essential Splice Site Available for shipment Available now
sa34943 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18239 Nonsense Available for shipment Available now
sa13565 Essential Splice Site Available for shipment Available now
sa41694 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9332 Nonsense Mutation detected in F1 DNA Not yet available
sa18990 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41692
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Nonsense 239 5056 9 105
ENSDART00000137089 Nonsense 205 5028 8 104
Genomic Location (Zv9):
Chromosome 10 (position 34448131)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33476096
GRCz11 10 33419956
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTGGAGGGCATGTTCTTCGTCTATTTCACGGGCACATGGATGAGTGTT[T/G]AACAATTCCTGGCGCGGAGCAGGGCGACGATCAGAGACGGTGAGATACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21768
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Nonsense 365 5056 12 105
ENSDART00000137089 Nonsense 331 5028 11 104
Genomic Location (Zv9):
Chromosome 10 (position 34450135)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33478100
GRCz11 10 33421960
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGTATGGCGAGTCCATGTGCTTTGTGCAGCACGTCGCTACAAGTCTGT[G/A]GCTCACATATGCCTCGGTGGATGCCAAGTCTGCTCGGCTGGGACCACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41693
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Nonsense 458 5056 14 105
ENSDART00000137089 Nonsense 424 5028 13 104
Genomic Location (Zv9):
Chromosome 10 (position 34452171)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33480136
GRCz11 10 33423996
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCTGCCTCTAGACGCCATAGTTCTGTCATTGCAGGATCTCATCTTCTA[T/A]TTCCGACCTCCAGAAGAGGAGCTGGAACATGAGGAGAAGCAGACCAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21769
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Essential Splice Site 534 5056 15 105
ENSDART00000137089 Essential Splice Site 500 5028 14 104
Genomic Location (Zv9):
Chromosome 10 (position 34452527)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33480492
GRCz11 10 33424352
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGCCGAGTCGTGGAAAGAGATCGTCAACTTATTTTATGAGCTGCTGGG[T/C]TTGTCTCTGTTTACTCATGATTGTATGATGCAATTTAAAATGATGTACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34941
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Essential Splice Site 902 5056 22 105
ENSDART00000137089 Essential Splice Site 868 5028 21 104
Genomic Location (Zv9):
Chromosome 10 (position 34458209)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33486174
GRCz11 10 33430034
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGAGCTGTGGGCCGTCACTCGAATTGAACAGGGTTGGACATATGGACTA[G/A]TGAGTTTTTGAAAAAATTACATCAAGTATTAATATAATCCAAGGCTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24879
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Nonsense 1206 5056 29 105
ENSDART00000137089 Nonsense 1172 5028 28 104
Genomic Location (Zv9):
Chromosome 10 (position 34465539)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33493504
GRCz11 10 33437364
KASP Assay ID:
554-7528.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTTTTATACTCACCAGGCTTCATCCCTGTATGCAGTCTGGGTATGTCC[C/T]AGGTGGGTCGGATCAACCTTGGTCAAAATGTGAGCAGCCTGCGGTACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16264
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Nonsense 1884 5056 37 105
ENSDART00000137089 Nonsense 1850 5028 36 104
Genomic Location (Zv9):
Chromosome 10 (position 34479394)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33507359
GRCz11 10 33451219
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCCTGAACAGCAGCTGGTCTGCAAAGAGGAAGGAGCGGAGGTAAAAGAG[C/T]AAGAGGAACCAGCAGACGGTGGAAATGATGGAGAGYTGCTGGATGAAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45414
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Nonsense 2015 5056 38 105
ENSDART00000137089 Nonsense 1981 5028 37 104
Genomic Location (Zv9):
Chromosome 10 (position 34481286)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33509251
GRCz11 10 33453111
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGCTTTCTCAGACAAGTTTGTTAACCAAGTGCAGACCAATCAGAGACAG[C/T]GATATAATGAGCTCATGCAAGCTTTTACAATGAGTGCAGCAGAAACGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12583
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Nonsense 2054 5056 39 105
ENSDART00000137089 Nonsense 2020 5028 38 104
Genomic Location (Zv9):
Chromosome 10 (position 34481948)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33509913
GRCz11 10 33453773
KASP Assay ID:
2260-3439.1 (used for ordering genotyping assays)
KASP Sequence:
TAAACTATATTTTATATACAGGTGAACATGTTGATGAACTTTAAGAACTG[T/A]CCAGAGGAAGAAGATTGCCCCGTTCCWGAGGATGTCCGGAATGGCCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1535
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Nonsense 2234 5056 42 105
ENSDART00000137089 Nonsense 2200 5028 41 104
Genomic Location (Zv9):
Chromosome 10 (position 34489748)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33517606
GRCz11 10 33461466
KASP Assay ID:
554-1458.1 (used for ordering genotyping assays)
KASP Sequence:
CTCTTTCAGAAATATTATGAGTAACAGGGTATTTTACCAGCACCCCAACT[T/A]GATGAGAGCTCTGGGAATGCATGAGACAGTCATGGAGGTTATGGTGAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17197
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Nonsense 2368 5056 45 105
ENSDART00000137089 Nonsense 2334 5028 44 104
Genomic Location (Zv9):
Chromosome 10 (position 34493105)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33520963
GRCz11 10 33464823
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAAAGGGTTACCCGGATATTGGATGGAACCCAGTTGGAGGAGAAAAGTA[T/G]CTGGAYTTCCTGCGCTTTGCTGTGTTTGTGAATGGTTTGTAAAATATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34942
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Essential Splice Site 2380 5056 45 105
ENSDART00000137089 Essential Splice Site 2346 5028 44 104
Genomic Location (Zv9):
Chromosome 10 (position 34493141)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33520999
GRCz11 10 33464859
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGGAGAAAAGTATCTGGATTTCCTGCGCTTTGCTGTGTTTGTGAATGG[T/C]TTGTAAAATATATGGTTGTATCTCTCTTTAAAAAAGTGTTTAGTTTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34943
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Essential Splice Site 2576 5056 49 105
ENSDART00000137089 Essential Splice Site 2542 5028 48 104
Genomic Location (Zv9):
Chromosome 10 (position 34495686)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33523544
GRCz11 10 33467404
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGAAGTGGGTTTCCTGCCTGATATGAGGGCGGCAGCCTCCTTAGACACA[G/T]TAAGATGCACACCATACCTTTTTTACTAACATTTACTACATTTAAATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18239
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Nonsense 2894 5056 57 105
ENSDART00000137089 Nonsense 2860 5028 56 104
Genomic Location (Zv9):
Chromosome 10 (position 34499012)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33526870
GRCz11 10 33470730
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTGTTYTCTTACTTTCTTAAWAGGCAACCTATGACCCCAGTCATGGCTA[T/G]AGCCCCCAACCTATTGATATCTCAGGCAKGACACTGTCCAGAGAGCTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13565
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Essential Splice Site 2911 5056 57 105
ENSDART00000137089 Essential Splice Site 2877 5028 56 104
Genomic Location (Zv9):
Chromosome 10 (position 34499064)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33526922
GRCz11 10 33470782
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCCCCCAACCTATTGATATCTCAGGCAKGACACTGTCCAGAGAGCTACAG[G/A]TACACAATACAACATCAACTTAGAMTTAAAGAGCCCCTATTATGCATTNA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27635
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Nonsense 3841 5056 82 105
ENSDART00000137089 Nonsense 3813 5028 81 104
Genomic Location (Zv9):
Chromosome 10 (position 34534691)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33562549
GRCz11 10 33506409
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTCTTCCACCCTAAAACTTGGCATTTCTATTTTAAATGGCGGGAACTG[T/A]GAAGTTCAGCAGGTTAGTTGTGAAAGACCTACAGTATATTAAAGATTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41694
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Essential Splice Site 4030 5056 88 105
ENSDART00000137089 Essential Splice Site 4002 5028 87 104
Genomic Location (Zv9):
Chromosome 10 (position 34544637)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33572495
GRCz11 10 33516355
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTGGGCTTTCTGCACGTGTTTGCTCATATGATGATGAAACTGGCTCAG[G/A]TAACCCACATAAACTTGATTGTACTGTTGCTCATTTCATTCTATCTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9332
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Nonsense 4193 5056 90 105
ENSDART00000137089 Nonsense 4165 5028 89 104
ENSDART00000014749 Nonsense 4193 5056 90 105
ENSDART00000137089 Nonsense 4165 5028 89 104
Genomic Location (Zv9):
Chromosome 10 (position 34547838)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33575696
GRCz11 10 33519556
KASP Assay ID:
2260-3444.1 (used for ordering genotyping assays)
KASP Sequence:
CCGAACATGTTCCTCACGATACAAGACTGCAGAACTTCCTCGAAMAAGCC[G/T]AGAGCGTCCTGAACTATTTCCGCCCATTCTTGGGTCGCATCGAGATCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18990
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Nonsense 4193 5056 90 105
ENSDART00000137089 Nonsense 4165 5028 89 104
ENSDART00000014749 Nonsense 4193 5056 90 105
ENSDART00000137089 Nonsense 4165 5028 89 104
Genomic Location (Zv9):
Chromosome 10 (position 34547838)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33575696
GRCz11 10 33519556
KASP Assay ID:
2260-3444.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGAACATGTTCCTCACGATACAAGACTGCAGAACTTCCTCGAACAAGCC[G/T]AGAGCGTCCTGAACTATTTCCGCCCATTCTTGGGTCGCATCGAGATCATG
Associated Phenotype:
Not determined