Busch Lab

ZMP

AADAT

Ensembl ID:
ENSDARG00000011410
Description:
aminoadipate aminotransferase [Source:HGNC Symbol;Acc:17929]
Human Orthologue:
AADAT
Human Description:
aminoadipate aminotransferase [Source:HGNC Symbol;Acc:17929]
Mouse Orthologue:
Aadat
Mouse Description:
aminoadipate aminotransferase Gene [Source:MGI Symbol;Acc:MGI:1345167]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa31550 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31550
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019527 Essential Splice Site 263 394 7 12
Genomic Location (Zv9):
Chromosome 7 (position 8516532)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 7449918
GRCz11 7 7683287
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGACGTGTGCTGCGAACAGACTCCTTCTCCAAGATTCTGTCATCAGGG[T/C]GAGTGTGTGTGTTTACAGTACCCCTGTATACTATAGAGGCACAATGTGTG
Associated Phenotype:
Not determined