Busch Lab

ZMP

fen1

Ensembl ID:
ENSDARG00000011404
ZFIN ID:
ZDB-GENE-031112-11
Description:
Fen1 proteinFlap structure-specific endonuclease 1 [Source:UniProtKB/TrEMBL;Acc:Q6TNU4]
Human Orthologue:
FEN1
Human Description:
flap structure-specific endonuclease 1 [Source:HGNC Symbol;Acc:3650]
Mouse Orthologue:
Fen1
Mouse Description:
flap structure specific endonuclease 1 Gene [Source:MGI Symbol;Acc:MGI:102779]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa37839 Nonsense Mutation detected in F1 DNA Not yet available
sa15638 Essential Splice Site Available for shipment Available now
sa24456 Nonsense Available for shipment Available now
sa32479 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37839
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024224 Nonsense 104 380 5 12
Genomic Location (Zv9):
Chromosome 24 (position 11685843)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 11773156
GRCz11 24 11913300
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGACAATTGCAAACACTTATATTGCAGCTTGAGAAGAGAGTTGAGAGA[C/T]GAGCAGAGGCTGAGAAACTTCTAGCTCAGGCACAAGAAGCAGGTACAGAC
Long Flanking Sequence:
AGTTTTAAAAATCTTTTTTTCCCCACCCCACACAAAAAAAAAAAAAAATCGTGATACGAATCGAATCGTGGGTTTGGTGTATCGTTACAGCCCTAAAAATATATATATATATAATATAATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATATATATATATATATATATATATATATATATATATATAATTTTTTTTTTTTTTTTTTTTTTATTAATTTTTTTACTGTATGTGGAAAGGTAACTTGGCAGATGTAGTAGTGTAAAATAGTGCAGTTGAATGTATTGTAAAAAATGTGTGTAAGTTTTTTGTCTTTCCATCAAATAGTCATAAGTTGCTGATGTGACAATAAATAAACGGCATTTTTGCAGTCTTGATGTGACAATTGCAAACACTTATATTGCAGCTTGAGAAGAGAGTTGAGAGA[C/T]GAGCAGAGGCTGAGAAACTTCTAGCTCAGGCACAAGAAGCAGGTACAGACACCATCAAAAATGTACTTTTTCATAAAAAAAATATAATTTTCTTAAAGTCCTAATTAAAACCATTCTTACAGGTGAGCAGGAAAATATTGACAAGTTTAGTAAACGACTAGTGAAGGTAACCAAACAACACAATGAGGAATGCAAGAAATTACTTTCTCTAATGGGAGTCCCATACATTGAGGTACCACCACAGTCACGGATAGTCAAATATTTGTCATTTTTCTGATCATTAGTTTGCGGATATAAATATAATTAAATGCTTCTCTAACATTTAGGCTCCATGTGAGGCAGAGGCGAGTTGTGCTGCTCTGGTGAAAGCAGGGAAGGTTTATGCCACAGCAACAGAAGATATGGACGGTCTGACATTTGGAACAACGGTCTTATTGAGGCATCTAACAGCTAGTGAAGCAAAGTATGTATGAATACTCTTTATATTTGTAATTACCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15638
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024224 Essential Splice Site 118 380 5 12
Genomic Location (Zv9):
Chromosome 24 (position 11685887)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 11773200
GRCz11 24 11913344
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGAGACGAGCAGAGGCTGAGAAACTTCTAGCTCAGGCACAAGAAGCAGG[T/C]ACAGACACCATCAAAAATGTACTTTTTCATAAAAAAAATATAATTTTCTT
Long Flanking Sequence:
AAAATCGTGATACGAATCGAATCGTGGGTTTGGTGTATCGTTACAGCCCTAAAAATATATATATATATAATATAATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATATATATATATATATATATATATATATATATATATATAATTTTTTTTTTTTTTTTTTTTTTATTAATTTTTTTACTGTATGTGGAAAGGTAACTTGGCAGATGTAGTAGTGTAAAATAGTGCAGTTGAATGTATTGTAAAAAATGTGTGTAAGTTTTTTGTCTTTCCATCAAATAGTCATAAGTTGCTGATGTGACAATAAATAAACGGCATTTTTGCAGTCTTGATGTGACAATTGCAAACACTTATATTGCAGCTTGAGAAGAGAGTTGAGAGACGAGCAGAGGCTGAGAAACTTCTAGCTCAGGCACAAGAAGCAGG[T/C]ACAGACACCATCAAAAATGTACTTTTTCATAAAAAAAATATAATTTTCTTAAAGTCCTAATTAAAACCATTCTTACAGGTGAGCAGGAAAATATTGACAAGTTTAGTAAACGACTAGTGAAGGTAACCAAACAACACAATGAGGAATGCAAGAAATTACTTTCTCTAATGGGAGTCCCATACATTGAGGTACCACCACAGTCACGGATAGTCAAATATTTGTCATTTTTCTGATCATTAGTTTGCGGATATAAATATAATTAAATGCTTCTCTAACATTTAGGCTCCATGTGAGGCAGAGGCGAGTTGTGCTGCTCTGGTGAAAGCAGGGAAGGTTTATGCCACAGCAACAGAAGATATGGACGGTCTGACATTTGGAACAACGGTCTTATTGAGGCATCTAACAGCTAGTGAAGCAAAGTATGTATGAATACTCTTTATATTTGTAATTACCCTTTGAATATAATGTAGTGACATGGATGTACTGTAATGACAGATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24456
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024224 Nonsense 214 380 8 12
Genomic Location (Zv9):
Chromosome 24 (position 11686467)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 11773780
GRCz11 24 11913924
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCATTTTAGAAAGCTCCCCATCCAAGAGTTTCACTTCAGTCGTATTCTG[C/T]AGGATATGGAGCTGACGCATCAACAGGTGAGTAATATATCAACATGTCTA
Long Flanking Sequence:
TGAGCAGGAAAATATTGACAAGTTTAGTAAACGACTAGTGAAGGTAACCAAACAACACAATGAGGAATGCAAGAAATTACTTTCTCTAATGGGAGTCCCATACATTGAGGTACCACCACAGTCACGGATAGTCAAATATTTGTCATTTTTCTGATCATTAGTTTGCGGATATAAATATAATTAAATGCTTCTCTAACATTTAGGCTCCATGTGAGGCAGAGGCGAGTTGTGCTGCTCTGGTGAAAGCAGGGAAGGTTTATGCCACAGCAACAGAAGATATGGACGGTCTGACATTTGGAACAACGGTCTTATTGAGGCATCTAACAGCTAGTGAAGCAAAGTATGTATGAATACTCTTTATATTTGTAATTACCCTTTGAATATAATGTAGTGACATGGATGTACTGTAATGACAGATTTTTGGGCATGAACAAGAAACTGATTATCTTTTTCATTTTAGAAAGCTCCCCATCCAAGAGTTTCACTTCAGTCGTATTCTG[C/T]AGGATATGGAGCTGACGCATCAACAGGTGAGTAATATATCAACATGTCTATTTCTCTCATTTTGTACATTTAATCCCTGCCTTCAATAAGCATCTGTTCTATCTAATTCTGTTTGTTTGAATGTCTTCCTCAGTTCATCGACCTGTGTATCCTGCTGGGCTGTGACTACTGTGGCACTATAAAGGGAATCGGACCCAAGAGGGCCATTGACCTAATTAAACAGCATGGCTCTATTGAAGAAATTCTGGAGAATATTGACCCAAATGTAAGTTTATTTGAGCCGTTCAAATGCATTAACTTGCTGTTGAAGAGAGGTTATTGTGTTTTTAATATAATAGAGATCTGAGTTTAAACCTGTTAAGTTAAAAAAAGTTTTTCTGTGGTTGAACACAAGTTTTTCTGTGGTTGAAGAAGGTATTTGAATGCTGGTTGCTGGTGTCCATTGACTTTTATAGTAGGACAAAAATTACTATGGTAGTAAATGGGTGCCAGCAACCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32479
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024224 Nonsense 339 380 11 12
Genomic Location (Zv9):
Chromosome 24 (position 11691426)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 11778739
GRCz11 24 11918883
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAACGGCTGTAAGAAGATCACAAAGAGCAGACAAGGCAGCACCCAGGGC[C/T]GACTGGACACATTCTTTACTGTAACCGGATCAATCTCTTCTAAGCGTAAG
Long Flanking Sequence:
CATGCTGAACATGCAAGTTAAAATTAAATATTCTCTTTCAGTTTTCATGGTCACAACCTCATAGGATATAGTCAATACATTGAATTGATAAGGTGAATAGGTCTACACTTAGAATGAAGTCAATTTTGCATGATTAATTTGTCACAGTGTCTTTACGACTGGGTTCCCCATTTTTTTATTTAAATGGACTTGATTTTAAACTTTGCCTTCTGAAATCCTAAGTTTAGTTTAAAGAGAAAAAATAAAATAGTTTTTTTACCAGCTACCTTTTTAAAAATGTACTTTTGAATTATTTAAATTATTTTATCACAATGTTCTTTGTGAAAAGGATCTTTATTGTGTGTAAACCCAAATTGTCTTGTATTTGGGTTACATTCTCACAGCAGCTGAATATGTTTGTCAGATGTCTAATGTTTTTTAACTTGTGTGTTGTCAGTGAGGATCGTATCCGTAACGGCTGTAAGAAGATCACAAAGAGCAGACAAGGCAGCACCCAGGGC[C/T]GACTGGACACATTCTTTACTGTAACCGGATCAATCTCTTCTAAGCGTAAGGTAGGAGGATGTAATAACTGAGAAATCTGTCCTAACTGAAGATTAATAGCCATACTGTAATAATTCTTATAAAATATTTGTTGTTAAAACTTTTTAACACTTATAAATTTGTCTTGTTTTTCCCTAGGAGCCTGAAACAAAGGGATCTGCCAAAAAGAAACAAAAGACAAGTGCTACGCCAGGCAAATTTAAGAAGGGCAAATGAAAGGGATTTCTGCAAAATGAGTTTATTTCATATCGTCACTTCTTATTGCTAAAAAAACAAAAAAGTCAACATTACCTTTTGAGTATTTTAGGGGAACTATGTTTTAAATACCCTGTTGTGCTGTCTATCTTGAATAAAGATAAGTATTTAATGATTCCAGTGTGGTCTATTTTTTGGTGTTCATCTTCAAAGAATTGTGATCTTTGTTGGATGCGACACATTGCTGATGTTCACGATGTACAAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4275
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024224 Essential Splice Site 356 380 12 12
Genomic Location (Zv9):
Chromosome 24 (position 11691603)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 11778916
GRCz11 24 11919060
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTRTTGTTAAAACTTTTTAACACTTATAAATTTGTCTTGTTTTTCCCTA[G/T]GAGCCTGAAACAAAGGGATCTGCCAAAAAGAAACAAAAGACAAGTGCTAC
Long Flanking Sequence:
ATTTAAATGGACTTGATTTTAAACTTTGCCTTCTGAAATCCTAAGTTTAGTTTAAAGAGAAAAAATAAAATAGTTTTTTTACCAGCTACCTTTTTAAAAATGTACTTTTGAATTATTTAAATTATTTTATCACAATGTTCTTTGTGAAAAGGATCTTTATTGTGTGTAAACCCAAATTGTCTTGTATTTGGGTTACATTCTCACAGCAGCTGAATATGTTTGTCAGATGTCTAATGTTTTTTAACTTGTGTGTTGTCAGTGAGGATCGTATCCGTAACGGCTGTAAGAAGATCACAAAGAGCAGACAAGGCAGCACCCAGGGCCGACTGGACACATTCTTTACTGTAACCGGATCAATCTCTTCTAAGCGTAAGGTAGGAGGATGTAATAACTGAGAAATCTGTCCTAACTGAAGATTAATAGCCATACTGTAATAATTCTTATAAAATATTTGTTGTTAAAACTTTTTAACACTTATAAATTTGTCTTGTTTTTCCCTA[G/T]GAGCCTGAAACAAAGGGATCTGCCAAAAAGAAACAAAAGACAAGTGCTACGCCAGGCAAATTTAAGAAGGGCAAATGAAAGGGATTTCTGCAAAATGAGTTTATTTCATATCGTCACTTCTTATTGCTAAAAAAACAAAAAAGTCAACATTACCTTTTGAGTATTTTAGGGGAACTATGTTTTAAATACCCTGTTGTGCTGTCTATCTTGAATAAAGATAAGTATTTAATGATTCCAGTGTGGTCTATTTTTTGGTGTTCATCTTCAAAGAATTGTGATCTTTGTTGGATGCGACACATTGCTGATGTTCACGATGTACAAGCAAAAGGCTGACAACACCAATGAATTTTTGTATTTTGCCCTACAGCATTTTCAGCCCACAAGCTTTTCTTAGCTCTTCACCATTCTGTCAGAGCAAAAATAATTAACTCCAAACTAAAGCCTCTCTGTTGCCTGAATTTGGGTTGCTAAACAGGTTTGCATATGAGGAAGTACAACAG
Associated Phenotype:
Not determined