Busch Lab

ZMP

mknk2a

Ensembl ID:
ENSDARG00000011373
ZFIN ID:
ZDB-GENE-030131-6099
Description:
MAP kinase-interacting serine/threonine kinase 2 [Source:RefSeq peptide;Acc:NP_997888]
Human Orthologue:
MKNK2
Human Description:
MAP kinase interacting serine/threonine kinase 2 [Source:HGNC Symbol;Acc:7111]
Mouse Orthologue:
Mknk2
Mouse Description:
MAP kinase-interacting serine/threonine kinase 2 Gene [Source:MGI Symbol;Acc:MGI:894279]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa9168 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa19738 Nonsense Available for shipment Available now
sa11542 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8082
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027782 Nonsense 3 472 2 14

The following transcripts of ENSDARG00000011373 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 22465334)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23352039
GRCz11 2 23007690
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGATTTAGACNNNNNNCTGCACATCATTGGACCTTTGGAAAACATGGTG[C/T]AAAACAAGATCACTGAAGTAACCGGATTCCATCGCTCCTTTAAGGTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9168
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027782 Essential Splice Site 80 472 4 14

The following transcripts of ENSDARG00000011373 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 22465867)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23352572
GRCz11 2 23008223
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAGAAAAAGAGATGCAGAGCCACTGACAGTTTTTCCGGACGTTTTGAAG[G/A]CAAGCGGTTTTGTCWGTCCTCAAGTTTGCAGTTGAGCTTTACTATCTKTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19738
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027782 Nonsense 349 472 12 14

The following transcripts of ENSDARG00000011373 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 22479593)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23366298
GRCz11 2 23021949
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATTGGGCACACATCTCCCCTGCAGCCAAAGACCTCATCACCAAACTAT[T/A]GGTACGGGATGCCAAAGACCGCCTCAGTGCCGCCCAAGTCCTGCAGCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11542
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027782 Essential Splice Site 384 472 13 14

The following transcripts of ENSDARG00000011373 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 22480375)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23367080
GRCz11 2 23022731
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTCTTTAGTGTGCACCCAACACTGTGTCTGCATCYATACTACATCAGAG[G/A]TATGTATAGTGCNNNCTTATACTCCTCTAAATCTCATSCAGCAAACATAA
Associated Phenotype:
Not determined