Busch Lab

ZMP

atf7a

Ensembl ID:
ENSDARG00000011298
ZFIN ID:
ZDB-GENE-050721-2
Description:
cyclic AMP-dependent transcription factor ATF-7 [Source:RefSeq peptide;Acc:NP_001025376]
Human Orthologue:
ATF7
Human Description:
activating transcription factor 7 [Source:HGNC Symbol;Acc:792]
Mouse Orthologue:
Atf7
Mouse Description:
activating transcription factor 7 Gene [Source:MGI Symbol;Acc:MGI:2443472]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa37731 Nonsense Mutation detected in F1 DNA Not yet available
sa43995 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37731
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013563 Nonsense 157 497 5 11
Genomic Location (Zv9):
Chromosome 23 (position 27699275)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27532097
GRCz11 23 27458638
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTGGCTGATTATCGTCGCAGGATTCTCCTCCAAGGCATGCCTTCAGTT[C/A]AGCTCCAACCCCAGCCATAGTGCGTCCTGGATCCCTCCCTCTGCACCTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5054
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013563 Nonsense 304 497 8 11
Genomic Location (Zv9):
Chromosome 23 (position 27695716)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27528538
GRCz11 23 27455079
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCTTGGTGTGGCGATGGGCTCTAGTGCAATGGTGCCTCAGAGGGTGGAG[C/T]AAAGCCAGCTGCTGGTTCAGCATCCAGATGCTCCATCACCTGCYCAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43995
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013563 Nonsense 407 497 10 11
Genomic Location (Zv9):
Chromosome 23 (position 27688776)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27521598
GRCz11 23 27448139
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGAAACGAAGTTGCTCATCTAAAGCAGTTGCTGTTAGCCCATAAAGACTG[T/A]CCTGTCACCAACCTCCAGAAGAAAGCTGCCTATTTAGGTAAGTAGAGCTC
Associated Phenotype:
Not determined