Busch Lab

ZMP

enpp2

Ensembl ID:
ENSDARG00000011257
ZFIN ID:
ZDB-GENE-040426-1156
Description:
ectonucleotide pyrophosphatase/phosphodiesterase family member 2 [Source:RefSeq peptide;Acc:NP_9568
Human Orthologue:
ENPP2
Human Description:
ectonucleotide pyrophosphatase/phosphodiesterase 2 [Source:HGNC Symbol;Acc:3357]
Mouse Orthologue:
Enpp2
Mouse Description:
ectonucleotide pyrophosphatase/phosphodiesterase 2 Gene [Source:MGI Symbol;Acc:MGI:1321390]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6410 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa42664 Nonsense Mutation detected in F1 DNA Not yet available
sa36049 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6410
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047920 Essential Splice Site 41 850 3 25
ENSDART00000140527 None None 406 None 13
Genomic Location (Zv9):
Chromosome 16 (position 11081920)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9722979
GRCz11 16 9613881
KASP Assay ID:
554-4806.1 (used for ordering genotyping assays)
KASP Sequence:
TTAAGACTMATGTTCTACATGTGTTTTTGTCTTTTCTTCATGTTCAWTCA[A/T]GGTTTCTCTGACCAGCCATTTACCAGCCTGGCAGGTTCTTGCAAAAAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42664
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047920 Nonsense 210 850 7 25
ENSDART00000140527 None None 406 None 13
Genomic Location (Zv9):
Chromosome 16 (position 11089610)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9730669
GRCz11 16 9621571
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCACCATACATGAGGCCTATGTATCCTACAAAAACCTACCCAAATTTGTA[T/A]ACAATTACAACGGTATGTATTAATTGCAGATTTTCAGAATCTGCAAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36049
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047920 Nonsense 371 850 13 25
ENSDART00000140527 Nonsense 18 406 2 13
Genomic Location (Zv9):
Chromosome 16 (position 11100562)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9741621
GRCz11 16 9632523
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGGTATGGAGGAAGCTCATTGTGACAAAACAGAGTTCCTAAGTTCTTA[T/A]ATGTCCAACACTGAGGACCTCATCCTAATTCCTGGCTCTCTGGGAAGAAT
Associated Phenotype:
Not determined