Busch Lab

ZMP

si:ch211-12m10.1

Ensembl ID:
ENSDARG00000011171
ZFIN ID:
ZDB-GENE-060503-100
Description:
Novel protein similar to vertebrate odz, odd Oz/ten-m homolog 2 (Drosophila) (ODZ2) [Source:UniProtK
Human Orthologue:
ODZ2
Human Description:
odz, odd Oz/ten-m homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:29943]
Mouse Orthologue:
Odz2
Mouse Description:
odd Oz/ten-m homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1345184]

Alleles

There are 12 alleles of this gene:

Allele Name Consequence Status Availability
sa45742 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12677 Nonsense Available for shipment Available now
sa14272 Nonsense Available for shipment Available now
sa15048 Nonsense Available for shipment Available now
sa13815 Nonsense Available for shipment Available now
sa37350 Nonsense Available for shipment Available now
sa9107 Nonsense Mutation detected in F1 DNA Not yet available
sa10500 Nonsense Available for shipment Available now
sa23981 Nonsense Available for shipment Available now
sa23982 Nonsense Available for shipment Available now
sa43678 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4143
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040740 None None 1473 None 9
ENSDART00000135591 Nonsense 733 2515 13 25
Genomic Location (Zv9):
Chromosome 21 (position 30734788)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31934712
GRCz11 21 31967970
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATTGTCCCTAGTTTTGATCTGGTGGCYAATGGCGGAGGCTCTCTGGCCT[T/A]GCGGTTTGAGCGGGCTCCTTTTCAGAGTCAGGAACGGACARTGTGGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45742
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040740 Essential Splice Site 65 1473 2 9
ENSDART00000135591 Essential Splice Site 1107 2515 18 25
Genomic Location (Zv9):
Chromosome 21 (position 30753098)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31953022
GRCz11 21 31986280
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGTCATGCATGAGTATTGAGTTTTTATTCACTGTCGGCTCTTTCTTGC[A/G]GGAGTCGCACTGGATAAGAACGGCCTGATGTACTTTGTGGATGCTACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12677
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040740 Nonsense 179 1473 3 9
ENSDART00000135591 Nonsense 1221 2515 19 25
Genomic Location (Zv9):
Chromosome 21 (position 30757398)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31957322
GRCz11 21 31990580
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTYCCTGGCATTGATTACTCRCTCAGCAAACTTGCAATCCATTCTGCGT[T/A]GGAGAGCGCCACAGCTATCGCCATCTCCCACACAGGTGTGCTMTACATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14272
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040740 Nonsense 648 1473 7 9
ENSDART00000135591 Nonsense 1690 2515 23 25
Genomic Location (Zv9):
Chromosome 21 (position 30768490)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31968414
GRCz11 21 32001672
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTACTYGTTTTGTTTACGTNNNNNNTTTCTCTTNNNNNNNNNNTCTCYCTCTGCAGTCCATGGTGT[T/A]GCTGCTYCAGCAAAGTCAAAAGCARTACGTCTTTGATTTTGATACAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15048
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040740 Nonsense 890 1473 7 9
ENSDART00000135591 Nonsense 1932 2515 23 25
Genomic Location (Zv9):
Chromosome 21 (position 30769215)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31969139
GRCz11 21 32002397
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTTTCGCTCATTGATGTATTGGAKGACAGTGCAGTATGACAGCATGGGA[A/T]GAGTTATCAAAYGTGAGTTAAAGATTGGTCCCTATGCCAATACYACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13815
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040740 Nonsense 954 1473 7 9
ENSDART00000135591 Nonsense 1996 2515 23 25
Genomic Location (Zv9):
Chromosome 21 (position 30769409)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31969333
GRCz11 21 32002591
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTYCATTTGCTCAACCCGGGTAACAGTGCCCGTTTGCTGCCACTACGATA[T/A]GATCTTCGAGACCGAATTACGAGGTTGGGTGACATGCAGTAWCAACTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37350
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040740 Nonsense 957 1473 7 9
ENSDART00000135591 Nonsense 1999 2515 23 25
Genomic Location (Zv9):
Chromosome 21 (position 30769416)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31969340
GRCz11 21 32002598
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTCAACCCGGGTAACAGTGCCCGTTTGCTGCCACTACGATATGATCTT[C/T]GAGACCGAATTACGAGGTTGGGTGACATGCAGTATCAACTCGATGAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9107
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040740 Nonsense 968 1473 7 9
ENSDART00000135591 Nonsense 2010 2515 23 25
ENSDART00000040740 Nonsense 968 1473 7 9
ENSDART00000135591 Nonsense 2010 2515 23 25
Genomic Location (Zv9):
Chromosome 21 (position 30769451)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31969375
GRCz11 21 32002633
KASP Assay ID:
2261-5824.1 (used for ordering genotyping assays)
KASP Sequence:
CTACGATATGATCTTCGAGACCGAATTACGAGGTTGGGTGACATGCAGTA[T/A]CAACTCGATGARGACGGTGTGCTCATGCAGAGGGGCTCGGATGTATTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10500
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040740 Nonsense 968 1473 7 9
ENSDART00000135591 Nonsense 2010 2515 23 25
ENSDART00000040740 Nonsense 968 1473 7 9
ENSDART00000135591 Nonsense 2010 2515 23 25
Genomic Location (Zv9):
Chromosome 21 (position 30769451)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31969375
GRCz11 21 32002633
KASP Assay ID:
2261-5824.1 (used for ordering genotyping assays)
KASP Sequence:
CTACGATATGATCTTCGAGACCGAATTACGAGGTTGGGTGACATGCAGTA[T/A]CAACTCGATGARGACGGTGTGCTCATGCAGAGGGGCTCGGATGTATTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23981
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040740 Nonsense 1009 1473 7 9
ENSDART00000135591 Nonsense 2051 2515 23 25
Genomic Location (Zv9):
Chromosome 21 (position 30769574)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31969498
GRCz11 21 32002756
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCGAGCCTACAGCCGCACAGCAGGAGGTTGGAGTGTCCGTTACCGTTA[C/A]GATGGCCTTGGTCGCAGAGTCTCCCGCAGAACAAGTGAAGGCGAGCATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23982
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040740 Nonsense 1030 1473 7 9
ENSDART00000135591 Nonsense 2072 2515 23 25
Genomic Location (Zv9):
Chromosome 21 (position 30769637)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31969561
GRCz11 21 32002819
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCAGAGTCTCCCGCAGAACAAGTGAAGGCGAGCATCAGCAGTACTTCTA[T/A]GCAGACTTGAACTATCCCACTCGGGTCACCCATGTGTACAACCACACGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43678
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040740 Nonsense 1134 1473 7 9
ENSDART00000135591 Nonsense 2176 2515 23 25
Genomic Location (Zv9):
Chromosome 21 (position 30769947)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31969871
GRCz11 21 32003129
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTTCCATGGAGGGCTTTATGATTCTCTCACAAAGCTGGTGCATTTTGCC[C/T]AGAGAGACTATGATGTCCTGGCAGGAAGATGGATTGCACCTGACCATACG
Associated Phenotype:
Not determined