Busch Lab

ZMP

zgc:101847

Ensembl ID:
ENSDARG00000011170
ZFIN ID:
ZDB-GENE-041212-15
Description:
Protein NDRG2 [Source:UniProtKB/Swiss-Prot;Acc:Q5PR98]
Human Orthologue:
NDRG2
Human Description:
NDRG family member 2 [Source:HGNC Symbol;Acc:14460]
Mouse Orthologue:
Ndrg2
Mouse Description:
N-myc downstream regulated gene 2 Gene [Source:MGI Symbol;Acc:MGI:1352498]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa18676 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18676
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019949 Essential Splice Site 25 368 2 16
ENSDART00000141369 None None 130 None 6
Genomic Location (Zv9):
Chromosome 7 (position 4152847)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 3843261
GRCz11 7 3979273
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCATYACGGAGGAGAAGCCCTTACTGCCCGGTCAATCAGAYGCCGTCAAG[G/A]TCAACAAACACACANNNNNNNNNNTTKATAGAGTTCCGTCATTAGTTTATGCTTTGCTGC
Long Flanking Sequence:
AATAACTATTCATATATTCATAAAAAGATTGAGGTCATCTCCCAGTATTGCAGGATAAGTCGATATATTGATTATTGTGACAGGCCTAGCTGTATTCATATTGTAGGCTAGCATGCAGATGTTCAATAGTTAACAACTTCTTCTGTCACTAGTTGTATTAGCTCAGCCAGTCGAACAGCAGATGCAGTGATTTCTCCAGCGCTCTGCGAGGGAATGTATGAACTGTAATCTGTCTCTCTTTCTATGCTAATTTGTTCTAGCTGTAATTTCTAATTAAGAAGAGTCAAAGCCCAGCGGAGACGCGCAGCTCCCGCCGGAACAGCGTCTGTGCGCATGCGCCTCTCAGATCTGGCGCAGTGTTTATAATCTTCATCTGTGTGTGTGTTTGTGTTTCTGTGTGTTCAGGACGGCGTAAACCGATCATCATGACCACTGAGATGCAGGAGATCGCCATCACGGAGGAGAAGCCCTTACTGCCCGGTCAATCAGACGCCGTCAAG[G/A]TCAACAAACACACATTGATAGAGTTCCGTCATTAGTTTATGCTTTGCTGCCACCTGCTGGACACTTGGAAAACTTCAACACACTAATAGATCCGTGACACTATTGTTTATACCATGGGTGCACTGTAAAAAAAAAACACATTTTACAGAAAATATCCTTAAATTTTTTACAGTAATTTTTTGTAATTTCACATTCAAACAACCAATCTCTCTAAATTAACCGTTTGACTTTAATTTTAGGTACTTTATTATTAAAGACAAATTACTGACATTTGTGTTTTTTTATACAGGGAAATTACAGTATTATTTATACAGCATTTTTTCTATTATTTTAAATTATATTCAAAAGTTCGTAAAAATCACAAACATTATCTGTAAATTAACGGCTTGACTGTTATTCTATGTACTATATAATAGTGATGCGCGGATGGCCTATTATTTCATCCGCAACCGCATCATAAAACTCATCATCCGTCCGCCTTCCATCCGAACTAACATTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26871
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019949 Essential Splice Site 157 368 8 16
ENSDART00000141369 None None 130 None 6
Genomic Location (Zv9):
Chromosome 7 (position 4124767)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 3815181
GRCz11 7 3951193
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGGCGTTTGAAATAGTGTCTTTGTCTGATGTGTGTGTGTTTCCTATCA[G/A]TTGAATAACCCTGAGGCGGTGGAGGGTCTGGTTCTGGTCAATGTGGACCC
Long Flanking Sequence:
ATTGTAATACTAATTAATAAAAGTTAGAAGTGAATTATTAATAATAGGTGAATACTTCATTTATTAACTTTAATGTAATTTCCCCTCACTTGTGGTAATAGGGACAAACTGTTTACCCTCTATTTTACCTTTAAATATATTAAAGAAACCCAAAATATATTAAATACAACCCAGAAATCAGCAGCAGATGCTCAAAGACTGAATGCGGCCATCTGCTGGATAAAACATGAATAAATACAGCCCAAGGCGTTAATATTATATATATTTTTGCTGATATTTAAATATACAGTAAAAATGAGAAACGCTAAAATAAGATCATCATCATCATGACAGTGCATTATATTATTGTTAACTTGAAAAGCATACACTGATGATTACTAAAAATGAATGCAGTTTAGGTTTTCAGTGTTTTGAGCATCAGTATGCTTCAGCTTCTGTCTGCAGATGCGCACTGGCGTTTGAAATAGTGTCTTTGTCTGATGTGTGTGTGTTTCCTATCA[G/A]TTGAATAACCCTGAGGCGGTGGAGGGTCTGGTTCTGGTCAATGTGGACCCAAACGCTCGAGGCTGGATGGACTGGGCCGCACATAAGGTTTGCCTCCTTCAGTCTGTCTTCAGAAACACAGAGATTAAATCCCAGACACTTCATTAACATGAGCTTCTTCTTCTCCAGCTCTCCAACCTGACGTCTTCCCTCTCAGACCAAATCATCAGTCACCTCTTCAGTCAGGTGTGTGTGTGTGTGTATATGAGTGTTGCACATTTATAGGTCTGTGTATATAATTCACTGTATATATGTATATACAGCTGAAGTCAGAAGTATTAGCCCCCCTTTTGATTTTGATTTTTTTTTAATATTTCCCAAATGATGTTTAACAGAGCAAGTAAATTTTCACAGTATGCCTGATAATATTTTTTCTTCTGGAAAAAGTCTTTTTTGTTTTGTTTAGGCCAGAATAAAAGCAGTTTTAAATTTTTTAAACACAATTTTAAGGACAATATTAT
Associated Phenotype:
Not determined