Busch Lab

ZMP

anxa1c

Ensembl ID:
ENSDARG00000011168
ZFIN ID:
ZDB-GENE-030131-5274
Description:
annexin A1c [Source:RefSeq peptide;Acc:NP_861425]
Human Orthologue:
ANXA1
Human Description:
annexin A1 [Source:HGNC Symbol;Acc:533]
Mouse Orthologue:
Anxa1
Mouse Description:
annexin A1 Gene [Source:MGI Symbol;Acc:MGI:96819]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa1750 Essential Splice Site Available for shipment Available now
sa25318 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18826 Nonsense Mutation detected in F1 DNA Not yet available
sa12045 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1750
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006947 Essential Splice Site 124 341 5 12
ENSDART00000073931 None None 284 None 11
ENSDART00000135462 None None 246 None 10

The following transcripts of ENSDARG00000011168 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 67524423)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64326064
GRCz11 5 65015061
KASP Assay ID:
554-1743.1 (used for ordering genotyping assays)
KASP Sequence:
CATAAAAACACCTAAATGTACTTACCTGCTTGCTTACTTAACTGATACTC[A/G]GGGTCTTGGGACAAGTGAGAATGTCCTGAGTGAAATTCTGGGGACAAGGT
Long Flanking Sequence:
TGCGCTGAAAAAGGCGCTTTCCTCCCATCTTGAGGATGTGGTGCTGGCCTTGTTGATGACCCCTTCTGAATATGATGCTTTTGAGATGAAAAACGCATTGAAGGTACAGCTGATCTTATTGCAAAATAACTTATCTAACGTCTTAAAGGGATAGTTCACCCAAAATTGAAAATGTACTTACCATTTAGGTTTTAAACCTTTATCAGTTAATTTCTTTTTCTGTTGAACTCTAAAAAAGTCAGACTGGAAAGCATTGACATCCATAGTAGGAAAAAGGTACAATGGAACCATAGTTTCATAGTTTATACCAGTTTCAAGCAATCTTCAAAATATCTTCTTTTGAAGATAGAAAAAAACTGTTTGGGTCAGATGAAGGAAGCGTAAATTAATTTTAAAACTTTTAATTTCTTTAAGAAAACTTTCTATTTTGGGTGTATTAAGCCTTTAATACATAAAAACACCTAAATGTACTTACCTGCTTGCTTACTTAACTGATACTC[A/G]GGGTCTTGGGACAAGTGAGAATGTCCTGAGTGAAATTCTGGGGACAAGGTCAAACAAGGAGATTACGGCGCTGAAGAATAGTTTCAAAGAAGGTAACAAAAATCACATAAATACTACATCCCAAAGCAGATGTACTGAATGTGTAAGCTGCTGTACTTTTTCAGTGACACTTTAGTTCAAGTAATAATTTACACCATTTAGTACTGGATTATTATCTGCCTATTATAAAGATATTAACTGTTTATTAGCACTTTTTCAGTATGATTATTTTACATCTCTAATCATATCCTAAATACCTAAACACAGCTACTACCTTACTATTAATAAGCAGCTAATTAGTAGTTTACTGAGCTAAAAGTCTTGGTTAGTGATTTATTAGTATTGTGAATTATGCATTAAATAAAGTGTGACCCCTTTTCTGCTATGCAGTATATGGCGAGATGCTGGAGGAAGATATTAATAGTGATGTAAAAGGAAATCTTGAAACTGCCCTGCTTGCC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2262
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006947 Essential Splice Site 154 341 6 12
ENSDART00000073931 None None 284 None 11
ENSDART00000135462 None None 246 None 10

The following transcripts of ENSDARG00000011168 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 67523995)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64325636
GRCz11 5 65014633
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTATTGTGAATTATGCATTAAATAAAGTGTGACCCCTTTTCTGCTATGC[A/G]GTATATGGCGAGATGCTGGAGGAAGATATTAATAGTGATGTAAAAGGAAA
Long Flanking Sequence:
TGGGTGTATTAAGCCTTTAATACATAAAAACACCTAAATGTACTTACCTGCTTGCTTACTTAACTGATACTCAGGGTCTTGGGACAAGTGAGAATGTCCTGAGTGAAATTCTGGGGACAAGGTCAAACAAGGAGATTACGGCGCTGAAGAATAGTTTCAAAGAAGGTAACAAAAATCACATAAATACTACATCCCAAAGCAGATGTACTGAATGTGTAAGCTGCTGTACTTTTTCAGTGACACTTTAGTTCAAGTAATAATTTACACCATTTAGTACTGGATTATTATCTGCCTATTATAAAGATATTAACTGTTTATTAGCACTTTTTCAGTATGATTATTTTACATCTCTAATCATATCCTAAATACCTAAACACAGCTACTACCTTACTATTAATAAGCAGCTAATTAGTAGTTTACTGAGCTAAAAGTCTTGGTTAGTGATTTATTAGTATTGTGAATTATGCATTAAATAAAGTGTGACCCCTTTTCTGCTATGC[A/G]GTATATGGCGAGATGCTGGAGGAAGATATTAATAGTGATGTAAAAGGAAATCTTGAAACTGCCCTGCTTGCCCTTTGCAAGGTATAAAAATAGCATATTCCCTCTAAATTTAATTGGAATGAGTATTGCATAGGTGATTATGTGTATTGCGGACAATTACATATTTATATCTCCTAAGGCTACCAGGAGTGAAGATCGTAATATTGATGACGCACAGGCTAAGAGTGATGCAAAGGTAAGGAGAATTTACTTATTATTTTTTACTTACATCTATATTCACAAATTCAGCTTTGACTTTCTTCTTGTGTTTAATGCATATATATGGTAGGAGAAAAACGAATGATAGACCGTGAGTCTTTCTCTAACGTTTCTGAATTGATTTTAAATAGTTCAGAATCACTTTCCTTTGCCTTATTCCCTGTTGTTATCAGGGGTCGCCACAGTGGAAAAACCACCAGTTCCTTTAGCAATTGTTTTACACAGCGGATGCCTTTTCAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25318
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006947 Essential Splice Site 154 341 6 12
ENSDART00000073931 None None 284 None 11
ENSDART00000135462 None None 246 None 10

The following transcripts of ENSDARG00000011168 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 67523994)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64325635
GRCz11 5 65014632
KASP Assay ID:
554-7563.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTATTGTGAATTATGCATTAAATAAAGTGTGACCCCTTTTCTGCTATGCA[G/A]TATATGGCGAGATGCTGGAGGAAGATATTAATAGTGATGTAAAAGGAAAT
Long Flanking Sequence:
GGGTGTATTAAGCCTTTAATACATAAAAACACCTAAATGTACTTACCTGCTTGCTTACTTAACTGATACTCAGGGTCTTGGGACAAGTGAGAATGTCCTGAGTGAAATTCTGGGGACAAGGTCAAACAAGGAGATTACGGCGCTGAAGAATAGTTTCAAAGAAGGTAACAAAAATCACATAAATACTACATCCCAAAGCAGATGTACTGAATGTGTAAGCTGCTGTACTTTTTCAGTGACACTTTAGTTCAAGTAATAATTTACACCATTTAGTACTGGATTATTATCTGCCTATTATAAAGATATTAACTGTTTATTAGCACTTTTTCAGTATGATTATTTTACATCTCTAATCATATCCTAAATACCTAAACACAGCTACTACCTTACTATTAATAAGCAGCTAATTAGTAGTTTACTGAGCTAAAAGTCTTGGTTAGTGATTTATTAGTATTGTGAATTATGCATTAAATAAAGTGTGACCCCTTTTCTGCTATGCA[G/A]TATATGGCGAGATGCTGGAGGAAGATATTAATAGTGATGTAAAAGGAAATCTTGAAACTGCCCTGCTTGCCCTTTGCAAGGTATAAAAATAGCATATTCCCTCTAAATTTAATTGGAATGAGTATTGCATAGGTGATTATGTGTATTGCGGACAATTACATATTTATATCTCCTAAGGCTACCAGGAGTGAAGATCGTAATATTGATGACGCACAGGCTAAGAGTGATGCAAAGGTAAGGAGAATTTACTTATTATTTTTTACTTACATCTATATTCACAAATTCAGCTTTGACTTTCTTCTTGTGTTTAATGCATATATATGGTAGGAGAAAAACGAATGATAGACCGTGAGTCTTTCTCTAACGTTTCTGAATTGATTTTAAATAGTTCAGAATCACTTTCCTTTGCCTTATTCCCTGTTGTTATCAGGGGTCGCCACAGTGGAAAAACCACCAGTTCCTTTAGCAATTGTTTTACACAGCGGATGCCTTTTCAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18826
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006947 Nonsense 245 341 9 12
ENSDART00000073931 Nonsense 188 284 8 11
ENSDART00000135462 Nonsense 150 246 7 10
ENSDART00000006947 Nonsense 245 341 9 12
ENSDART00000073931 Nonsense 188 284 8 11
ENSDART00000135462 Nonsense 150 246 7 10

The following transcripts of ENSDARG00000011168 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 67521077)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64322718
GRCz11 5 65011715
KASP Assay ID:
2259-6765.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATCCACAGTTTTCCAATATTATAGCCAATTAAGCAAAGATGGTTTGGCC[A/T]AAGATCTGGAGGGCGAGCTGAGTGGACACCTTGAAGACTGCCTGATGACT
Long Flanking Sequence:
GCCAACAGGTACAGCCGGGATATAAACCAGCAACCTTCTTGCTGTGAGGCAACAGTACTAAGCACTGAGCCATCGTGCCACCAAGCAAAAAAATCTTGCGAAATACTATAGGTAGTAAGATATTATGTACTGTGATCATGGCATACAAAAGAAATTAGCATGTGATTTTGAACTTCTCTACATTTCTGATTTCTCAATAGCTGTCAATCACATTTTTGTTTTGTAGACTGCTTATCAAGCAAGGATTGTATAAAACGCATGATGTATCTCTGATCTCGTGTTGTTTCAGGCTTTGTTTGAGGCAGGAGAGAATCGGATCGGTACAGTTTGCTCAGTTCTGATTGACATCCTCACAAACAGGAGTGAAGCTCAGCTGTGCAAAAGTAGGATATCTGTCACTTATGTGATTGTGGTAAAGTTTAGCAGACTAGAATTAACAGTGTTATTTAAAATCCACAGTTTTCCAATATTATAGCCAATTAAGCAAAGATGGTTTGGCC[A/T]AAGATCTGGAGGGCGAGCTGAGTGGACACCTTGAAGACTGCCTGATGACTCTGGGTAAATATACTGTACATGTTTTCTTTTCTTTTCTTTTCTTTTCTTTTTTTTTTCTTTTGTGTGATGTATTAGTGTGTGTGTTAAAAACAGAAACTAGACAAACGCTTCACTGTCCATCTGATTGAAGGAAGCTCCTTAGCAAGACAGACCTGTTTTTCCATCCTCAGATGTTTAGGGCGTTTTCACTCACTCTCAGTAAACGTATCACAACCAGATACAGCGTAAAAAAGAAATGTAATGGTTGAAAACATGTATAAACTGCATTCCCAACAGTTTAATCGCTCTTTTATGTTTTAGTGAAGGCTGCTTGGAATAAACCTGCCTACTTTGCGGAAAAGCTCCAACATGCTATGAAGGTAAAGTTGCAGAGGAAGACATGGAATGTATACATTCATTTAGATCCATTTTGTTTCCATCGGAATCTAGTCAAAGTTGAAACCTTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12045
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006947 Nonsense 245 341 9 12
ENSDART00000073931 Nonsense 188 284 8 11
ENSDART00000135462 Nonsense 150 246 7 10
ENSDART00000006947 Nonsense 245 341 9 12
ENSDART00000073931 Nonsense 188 284 8 11
ENSDART00000135462 Nonsense 150 246 7 10

The following transcripts of ENSDARG00000011168 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 67521077)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64322718
GRCz11 5 65011715
KASP Assay ID:
2259-6765.1 (used for ordering genotyping assays)
KASP Sequence:
AATCCACAGTTTTCCAATATTATAGCCAATTAAGCAAAGATGGTTTGGCC[A/T]AAGATCTGGAGGGCGAGCTGAGTGGACACCTTGAAGACTGCCTGATGACT
Long Flanking Sequence:
GCCAACAGGTACAGCCGGGATATAAACCAGCAACCTTCTTGCTGTGAGGCAACAGTACTAAGCACTGAGCCATCGTGCCACCAAGCAAAAAAATCTTGCGAAATACTATAGGTAGTAAGATATTATGTACTGTGATCATGGCATACAAAAGAAATTAGCATGTGATTTTGAACTTCTCTACATTTCTGATTTCTCAATAGCTGTCAATCACATTTTTGTTTTGTAGACTGCTTATCAAGCAAGGATTGTATAAAACGCATGATGTATCTCTGATCTCGTGTTGTTTCAGGCTTTGTTTGAGGCAGGAGAGAATCGGATCGGTACAGTTTGCTCAGTTCTGATTGACATCCTCACAAACAGGAGTGAAGCTCAGCTGTGCAAAAGTAGGATATCTGTCACTTATGTGATTGTGGTAAAGTTTAGCAGACTAGAATTAACAGTGTTATTTAAAATCCACAGTTTTCCAATATTATAGCCAATTAAGCAAAGATGGTTTGGCC[A/T]AAGATCTGGAGGGCGAGCTGAGTGGACACCTTGAAGACTGCCTGATGACTCTGGGTAAATATACTGTACATGTTTTCTTTTCTTTTCTTTTCTTTTCTTTTTTTTTTCTTTTGTGTGATGTATTAGTGTGTGTGTTAAAAACAGAAACTAGACAAACGCTTCACTGTCCATCTGATTGAAGGAAGCTCCTTAGCAAGACAGACCTGTTTTTCCATCCTCAGATGTTTAGGGCGTTTTCACTCACTCTCAGTAAACGTATCACAACCAGATACAGCGTAAAAAAGAAATGTAATGGTTGAAAACATGTATAAACTGCATTCCCAACAGTTTAATCGCTCTTTTATGTTTTAGTGAAGGCTGCTTGGAATAAACCTGCCTACTTTGCGGAAAAGCTCCAACATGCTATGAAGGTAAAGTTGCAGAGGAAGACATGGAATGTATACATTCATTTAGATCCATTTTGTTTCCATCGGAATCTAGTCAAAGTTGAAACCTTACTT
Associated Phenotype:
Not determined