Busch Lab

ZMP

arhgef18

Ensembl ID:
ENSDARG00000011157
ZFIN ID:
ZDB-GENE-040516-14
Description:
rho/rac guanine nucleotide exchange factor (GEF) 18 [Source:RefSeq peptide;Acc:NP_999983]
Human Orthologue:
ARHGEF18
Human Description:
Rho/Rac guanine nucleotide exchange factor (GEF) 18 [Source:HGNC Symbol;Acc:17090]
Mouse Orthologue:
Arhgef18
Mouse Description:
rho/rac guanine nucleotide exchange factor (GEF) 18 Gene [Source:MGI Symbol;Acc:MGI:2142567]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa1637 Nonsense F2 line generated Not yet available
sa25861 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16319 Essential Splice Site Available for shipment Available now
sa19819 Nonsense Available for shipment Available now
sa38343 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa39886 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa1637
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025841 Nonsense 41 940 5 21
ENSDART00000133951 Nonsense 41 68 4 4
ENSDART00000143496 Nonsense 41 73 6 6
Genomic Location (Zv9):
Chromosome 2 (position 37247605)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37544315
GRCz11 2 37526772
KASP Assay ID:
554-1577.1 (used for ordering genotyping assays)
KASP Sequence:
ATCTCGTCATCTACACAGAATGCCATTATAATGTGCTGCGTGACGATCTG[G/T]AGTCCGATGCTCGGGACTTTGAGGCTCCSACCWGGAGTTTAGCTGTTGAC
Long Flanking Sequence:
TAAATCAGCCAAGGTGACCGCACAAAAACACACTAAGCTAAAAAATGGATTAACTGCAGTATTTGAATTACCACAAAATATTAGGTTATACTTTTCTCTGTCAATATGGGACCTAGCAAGAACGTTTATTAAACTGATCAGGGTATTTCTATTGCTACAAAAGCTTCAAAAAATGGTCTTTTGAATTAACCATTTTTCAAAAAATCCTTAAAGCATTAATAATTTATTGAGAGAAAATAGCACATCCAGTCTTGACTTTCTTTTTGTTTTTCAGAGCATAAGATGGATGATATTGATTATTACAGAAGCAAGCCTCTGGCAGAGGAATCAAATTTCCAGACCACAAACTATGACGCCATCAGTATTGACGGTTGGACACGTCACCTGTTTAATTGATGTTACATGTGTATTATCATCACAGCACTTGTTTGTTGACACTAAGGCAAGTGTATCTCGTCATCTACACAGAATGCCATTATAATGTGCTGCGTGACGATCTG[G/T]AGTCCGATGCTCGGGACTTTGAGGCTCCGACCTGGAGTTTAGCTGTTGACCCACAATATTTGAAAAACTTTTCCAAAGATGCCGTCAAAAGACAGGATGTAATACACGGTAAGGGACTGTGGTCTATTTTTGTTGTTTATTTGTTTATTTGTTTTTCATGAAATAATTTGAGCCATATTTATTTTAAATGGCTGTTAATGTTGTTCTCGCAGAGCTGATTCAGACAGAAATCAACCATGTGCGGACGCTAAAGATAGTTTTGAATGTGTACATTCGGGAGTTGCGTAACACCCTACAAATGGATGAGACACGACTGGAAAGGCTGTTTCCACAGGTGGAAAACCTGCTGGAGGTGCACCAGTTTTTCCTTGACAATCTTAAACTGCGAAGACTTGACTCTATGGAGCCTGGAAGCTCCCAGAATTACTGCATCCACAATCTTGGGGACATCCTTATCACACAGGTACCATTATTATATAACTGCTGTAGGATATTTATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25861
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025841 Essential Splice Site 77 940 5 21
ENSDART00000133951 None None 68 None 4
ENSDART00000143496 None None 73 None 6
ENSDART00000025841 Essential Splice Site 77 940 5 21
ENSDART00000133951 None None 68 None 4
ENSDART00000143496 None None 73 None 6
Genomic Location (Zv9):
Chromosome 2 (position 37247495)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37544205
GRCz11 2 37526662
KASP Assay ID:
554-6245.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGAAAAACTTTTCCAAAGATGCCGTCAAAAGACAGGATGTAATACACGG[T/A]AAGGGACTGTGGTCTATTTTTGTTGTTTATTTGTTTATTTGTTTTTCATG
Long Flanking Sequence:
ACCTAGCAAGAACGTTTATTAAACTGATCAGGGTATTTCTATTGCTACAAAAGCTTCAAAAAATGGTCTTTTGAATTAACCATTTTTCAAAAAATCCTTAAAGCATTAATAATTTATTGAGAGAAAATAGCACATCCAGTCTTGACTTTCTTTTTGTTTTTCAGAGCATAAGATGGATGATATTGATTATTACAGAAGCAAGCCTCTGGCAGAGGAATCAAATTTCCAGACCACAAACTATGACGCCATCAGTATTGACGGTTGGACACGTCACCTGTTTAATTGATGTTACATGTGTATTATCATCACAGCACTTGTTTGTTGACACTAAGGCAAGTGTATCTCGTCATCTACACAGAATGCCATTATAATGTGCTGCGTGACGATCTGGAGTCCGATGCTCGGGACTTTGAGGCTCCGACCTGGAGTTTAGCTGTTGACCCACAATATTTGAAAAACTTTTCCAAAGATGCCGTCAAAAGACAGGATGTAATACACGG[T/A]AAGGGACTGTGGTCTATTTTTGTTGTTTATTTGTTTATTTGTTTTTCATGAAATAATTTGAGCCATATTTATTTTAAATGGCTGTTAATGTTGTTCTCGCAGAGCTGATTCAGACAGAAATCAACCATGTGCGGACGCTAAAGATAGTTTTGAATGTGTACATTCGGGAGTTGCGTAACACCCTACAAATGGATGAGACACGACTGGAAAGGCTGTTTCCACAGGTGGAAAACCTGCTGGAGGTGCACCAGTTTTTCCTTGACAATCTTAAACTGCGAAGACTTGACTCTATGGAGCCTGGAAGCTCCCAGAATTACTGCATCCACAATCTTGGGGACATCCTTATCACACAGGTACCATTATTATATAACTGCTGTAGGATATTTATAGATTACAAATGTGATTCCGGACCACAAAAGCAGTCTTATGTGCAAATTGTCCTGAAAGCTGAATACATAATCTTTCCGTTGATGTTTAGTTTATTAGGATGTGAGCGGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16319
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025841 Essential Splice Site 77 940 5 21
ENSDART00000133951 None None 68 None 4
ENSDART00000143496 None None 73 None 6
ENSDART00000025841 Essential Splice Site 77 940 5 21
ENSDART00000133951 None None 68 None 4
ENSDART00000143496 None None 73 None 6
Genomic Location (Zv9):
Chromosome 2 (position 37247495)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37544205
GRCz11 2 37526662
KASP Assay ID:
554-6245.1 (used for ordering genotyping assays)
KASP Sequence:
TTGAAAAACTTTTCCAAAGATGCCGWCAAAAGACAGGATGTAATACACGG[T/G]AAGGGACTGTGGTCTWTTTTTKTTNGTTTATTTGTTTATTTGTTTTWCATG
Long Flanking Sequence:
ACCTAGCAAGAACGTTTATTAAACTGATCAGGGTATTTCTATTGCTACAAAAGCTTCAAAAAATGGTCTTTTGAATTAACCATTTTTCAAAAAATCCTTAAAGCATTAATAATTTATTGAGAGAAAATAGCACATCCAGTCTTGACTTTCTTTTTGTTTTTCAGAGCATAAGATGGATGATATTGATTATTACAGAAGCAAGCCTCTGGCAGAGGAATCAAATTTCCAGACCACAAACTATGACGCCATCAGTATTGACGGTTGGACACGTCACCTGTTTAATTGATGTTACATGTGTATTATCATCACAGCACTTGTTTGTTGACACTAAGGCAAGTGTATCTCGTCATCTACACAGAATGCCATTATAATGTGCTGCGTGACGATCTGGAGTCCGATGCTCGGGACTTTGAGGCTCCGACCTGGAGTTTAGCTGTTGACCCACAATATTTGAAAAACTTTTCCAAAGATGCCGTCAAAAGACAGGATGTAATACACGG[T/G]AAGGGACTGTGGTCTATTTTTGTTGTTTATTTGTTTATTTGTTTTTCATGAAATAATTTGAGCCATATTTATTTTAAATGGCTGTTAATGTTGTTCTCGCAGAGCTGATTCAGACAGAAATCAACCATGTGCGGACGCTAAAGATAGTTTTGAATGTGTACATTCGGGAGTTGCGTAACACCCTACAAATGGATGAGACACGACTGGAAAGGCTGTTTCCACAGGTGGAAAACCTGCTGGAGGTGCACCAGTTTTTCCTTGACAATCTTAAACTGCGAAGACTTGACTCTATGGAGCCTGGAAGCTCCCAGAATTACTGCATCCACAATCTTGGGGACATCCTTATCACACAGGTACCATTATTATATAACTGCTGTAGGATATTTATAGATTACAAATGTGATTCCGGACCACAAAAGCAGTCTTATGTGCAAATTGTCCTGAAAGCTGAATACATAATCTTTCCGTTGATGTTTAGTTTATTAGGATGTGAGCGGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19819
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025841 Nonsense 110 940 6 21
ENSDART00000133951 None None 68 None 4
ENSDART00000143496 None None 73 None 6
Genomic Location (Zv9):
Chromosome 2 (position 37247294)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37544004
GRCz11 2 37526461
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAATGTGTACATTCGGGAGTTGCGTAACACCCTACAAATGGATGAGACA[C/T]GACTGGAAAGGCTGTTTCCACAGGTGGAAAACCTGCTGGAGGTGCACCAG
Long Flanking Sequence:
GCCTCTGGCAGAGGAATCAAATTTCCAGACCACAAACTATGACGCCATCAGTATTGACGGTTGGACACGTCACCTGTTTAATTGATGTTACATGTGTATTATCATCACAGCACTTGTTTGTTGACACTAAGGCAAGTGTATCTCGTCATCTACACAGAATGCCATTATAATGTGCTGCGTGACGATCTGGAGTCCGATGCTCGGGACTTTGAGGCTCCGACCTGGAGTTTAGCTGTTGACCCACAATATTTGAAAAACTTTTCCAAAGATGCCGTCAAAAGACAGGATGTAATACACGGTAAGGGACTGTGGTCTATTTTTGTTGTTTATTTGTTTATTTGTTTTTCATGAAATAATTTGAGCCATATTTATTTTAAATGGCTGTTAATGTTGTTCTCGCAGAGCTGATTCAGACAGAAATCAACCATGTGCGGACGCTAAAGATAGTTTTGAATGTGTACATTCGGGAGTTGCGTAACACCCTACAAATGGATGAGACA[C/T]GACTGGAAAGGCTGTTTCCACAGGTGGAAAACCTGCTGGAGGTGCACCAGTTTTTCCTTGACAATCTTAAACTGCGAAGACTTGACTCTATGGAGCCTGGAAGCTCCCAGAATTACTGCATCCACAATCTTGGGGACATCCTTATCACACAGGTACCATTATTATATAACTGCTGTAGGATATTTATAGATTACAAATGTGATTCCGGACCACAAAAGCAGTCTTATGTGCAAATTGTCCTGAAAGCTGAATACATAATCTTTCCGTTGATGTTTAGTTTATTAGGATGTGAGCGGAGTGGAGCAGCAAGAATTTCCACGCTCAAACTATTTTCTCTCTGTCTCCACTCCTCTCCGGGTTTTCCATCCGCATATGTATTTCAACAATAAATGCATTGTAAAAATAAATTCATTTAAGTGTAAGTACACATTAGTTAAGGCCACCTGTAATAAAGTGTGAGCGTTTTTAAAACATGTAGTGTTGCATTACTTAAACTTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38343
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025841 Essential Splice Site 331 940 9 21
ENSDART00000133951 None None 68 None 4
ENSDART00000143496 None None 73 None 6
Genomic Location (Zv9):
Chromosome 2 (position 37242456)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37539166
GRCz11 2 37521623
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCAACTGGAGGGTCACGAACAACAAAGGCAAAGGTGATAAGCATACAG[G/A]TGAGATAAAAATTACAGCTGGATTATCTAGTAGTTGTTTACCAATCTTGA
Long Flanking Sequence:
TTTGTCAACACCCCTGTATTTAATTGGCACATCAAAGGTACATCTAAGGTTTTGTTTGTCTTCCCTTTTGCTTGACTTGAGATTAAACCATGTTTTTTCAGAACAGAGAGATTCCCGTGTTTCTGTGTAATTGATGCTCATTGTAACAAACACAACCAGAACATGCAGGTTCATTAGACAGCATCAATGAGAGTGCATGATTACGTTTTTTTTCCTTGTTCTTTTGACAGATGAGTCAGAAGAACAAATGGACCTGATAAAAGGGCTGGACTTTCTGAAGGACACCATAGCACAAGTGAATGCTCATGTGGACGAGGCTGAGAAAGAGGCACGACTGAGAGAACTTAGCAGTAAACTGGAGCCCAAGTCCCAGGTGAAGATGACCAGTGGGAGGGTGTTTCGTCGAGAGGACATGCTGCAGGGAAAGAGGAAGCTGCTTCATGAGGGCATGCTCAACTGGAGGGTCACGAACAACAAAGGCAAAGGTGATAAGCATACAG[G/A]TGAGATAAAAATTACAGCTGGATTATCTAGTAGTTGTTTACCAATCTTGATTTTAAATGACCGATTCCTGCAAATTCCAATAAAAACATGAGAACAAGCAGTTTATTTGCTGAAATATCTGCAGTCATTTTAAATTACAAGCACTGTGATGACACTCCATTAGCTTTGATAATTGGAAAATTAGGTTGTATAATTTTAAAATCTAAAATAAAAGCATAATGATTTGACTAGCTTTTTGAAATTATTCTACATAAAAACAAAGGGACATAACACAAAAAAATTGATGAGCTGAATAAAAATGCTAATTTACTCTCTTCCATTAGGTGGTACTAAACAGCAGGTAGAGTGGTGTATATGCTTGTATTCCAAATGCATTATTTTAAGGAAATAATAGTTTATTTTTCTCAACTAGAAATATCCAGCTCCAATGACATGATCGGAAATCGGGCCCGATTACATGGTTTTAGACTCAATCAAAATCGGATGTTACCTCCTGATCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5157
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025841 Nonsense 437 940 12 21
ENSDART00000133951 None None 68 None 4
ENSDART00000143496 None None 73 None 6
ENSDART00000025841 Nonsense 437 940 12 21
ENSDART00000133951 None None 68 None 4
ENSDART00000143496 None None 73 None 6
Genomic Location (Zv9):
Chromosome 2 (position 37235915)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37532625
GRCz11 2 37515082
KASP Assay ID:
2261-7174.1 (used for ordering genotyping assays)
KASP Sequence:
ACGTAAAGGAAGAAGAGCCRGAAGAACTCYCTAAGAAGATCTRKGAATTT[C/T]AAAGTAATGTGCAGATTNACTCATTCRCAGTCTGGGATTTTAGTCTTCCA
Long Flanking Sequence:
TGTAACAACTCTTGTGAAACCTCTTTACTGATCTTTCTGAATGAAATGCCTACTTTACTACATCTAATCAGCTCAAAGTAAAAAAGAGCCAAGCCCACTGTTTTCTCAATTATTATTCTGTTTATCTAGGAACTACGTCACAATATTAAAAATAAAAAATATGTTGCAGACTCCGATTCATGTAGACTTTAAATTTATTTTTTGACGCCACTCTAAGCTAATGATAATCTATGGTCAAAAGGTCAATCAGGCGGTTATGATGCCTGTTAATGGGTCAAGATTTATTGTAAATGTTAGCTAAATATTAATATTGTTTCTAACATTTCTTTTTTGACGCCACTCTAAGCTAATGATAATCTATGGTCAAAAGGTCAATCAGGCGGTTATGATGCCTGTTAATGGGTCAAGATTTATTGTAAATGTTAGCTAAATATTGTTTCAGCTGTCCAGACGTAAAGGAAGAAGAGCCAGAAGAACTCCCTAAGAAGATCTGGGAATTT[C/T]AAAGTAATGTGCAGATTTACTCATTCACAGTCTGGGATTTTAGTCTTCCATTTTTCTTCAGTAAAATGAACAGATGTCAGTTTTAACACTTGCTTTTTTCTGAGTAGGAAAGCTGTGTGTGCACGATGCCTCGATAGAGCAGCACCTGACAGAGAAGCTGAAGTTATTCTCCAGCATAGCAGCTTCAGTGACTGGTGTTTCTGACACCTCGACGAGTGAGCGCCATCCGCTACGTGGGAATGCAGCAGAGCCCCTGCAGGGAGAACGACTACTCACCGGAGCCCTGAAAGATGGTGAGATTTACACTGCACAGTACAAATGAGAATTTCACTATTGACCCCTTAATGCTTTTTTCAGTCCTTTGTGCATTTTAAAAATGGGTTGCGAGTTCTCAGCTGATTCAGTAAGACAACAGCCATACAACTATGCACATATGAGCTTGTTTAGCCCAGTACACAGCATTGTTTGGATTAATTTACTTTTTTTTATTCAATTCAATC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18733
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025841 Nonsense 437 940 12 21
ENSDART00000133951 None None 68 None 4
ENSDART00000143496 None None 73 None 6
ENSDART00000025841 Nonsense 437 940 12 21
ENSDART00000133951 None None 68 None 4
ENSDART00000143496 None None 73 None 6
Genomic Location (Zv9):
Chromosome 2 (position 37235915)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37532625
GRCz11 2 37515082
KASP Assay ID:
2261-7174.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGTAAAGGAAGAAGAGCCAGAAGAACTCCCTAAGAAGATCTGGGAATTT[C/T]AAAGTAATGTGCAGATTTACTCATTCACAGTCTGGGATTTTAGTCTTCCA
Long Flanking Sequence:
TGTAACAACTCTTGTGAAACCTCTTTACTGATCTTTCTGAATGAAATGCCTACTTTACTACATCTAATCAGCTCAAAGTAAAAAAGAGCCAAGCCCACTGTTTTCTCAATTATTATTCTGTTTATCTAGGAACTACGTCACAATATTAAAAATAAAAAATATGTTGCAGACTCCGATTCATGTAGACTTTAAATTTATTTTTTGACGCCACTCTAAGCTAATGATAATCTATGGTCAAAAGGTCAATCAGGCGGTTATGATGCCTGTTAATGGGTCAAGATTTATTGTAAATGTTAGCTAAATATTAATATTGTTTCTAACATTTCTTTTTTGACGCCACTCTAAGCTAATGATAATCTATGGTCAAAAGGTCAATCAGGCGGTTATGATGCCTGTTAATGGGTCAAGATTTATTGTAAATGTTAGCTAAATATTGTTTCAGCTGTCCAGACGTAAAGGAAGAAGAGCCAGAAGAACTCCCTAAGAAGATCTGGGAATTT[C/T]AAAGTAATGTGCAGATTTACTCATTCACAGTCTGGGATTTTAGTCTTCCATTTTTCTTCAGTAAAATGAACAGATGTCAGTTTTAACACTTGCTTTTTTCTGAGTAGGAAAGCTGTGTGTGCACGATGCCTCGATAGAGCAGCACCTGACAGAGAAGCTGAAGTTATTCTCCAGCATAGCAGCTTCAGTGACTGGTGTTTCTGACACCTCGACGAGTGAGCGCCATCCGCTACGTGGGAATGCAGCAGAGCCCCTGCAGGGAGAACGACTACTCACCGGAGCCCTGAAAGATGGTGAGATTTACACTGCACAGTACAAATGAGAATTTCACTATTGACCCCTTAATGCTTTTTTCAGTCCTTTGTGCATTTTAAAAATGGGTTGCGAGTTCTCAGCTGATTCAGTAAGACAACAGCCATACAACTATGCACATATGAGCTTGTTTAGCCCAGTACACAGCATTGTTTGGATTAATTTACTTTTTTTTATTCAATTCAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39886
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025841 Nonsense 491 940 13 21
ENSDART00000133951 None None 68 None 4
ENSDART00000143496 None None 73 None 6
Genomic Location (Zv9):
Chromosome 2 (position 37235649)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37532359
GRCz11 2 37514816
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGAGCGCCATCCGCTACGTGGGAATGCAGCAGAGCCCCTGCAGGGAGAA[C/T]GACTACTCACCGGAGCCCTGAAAGATGGTGAGATTTACACTGCACAGTAC
Long Flanking Sequence:
TTAATGGGTCAAGATTTATTGTAAATGTTAGCTAAATATTAATATTGTTTCTAACATTTCTTTTTTGACGCCACTCTAAGCTAATGATAATCTATGGTCAAAAGGTCAATCAGGCGGTTATGATGCCTGTTAATGGGTCAAGATTTATTGTAAATGTTAGCTAAATATTGTTTCAGCTGTCCAGACGTAAAGGAAGAAGAGCCAGAAGAACTCCCTAAGAAGATCTGGGAATTTCAAAGTAATGTGCAGATTTACTCATTCACAGTCTGGGATTTTAGTCTTCCATTTTTCTTCAGTAAAATGAACAGATGTCAGTTTTAACACTTGCTTTTTTCTGAGTAGGAAAGCTGTGTGTGCACGATGCCTCGATAGAGCAGCACCTGACAGAGAAGCTGAAGTTATTCTCCAGCATAGCAGCTTCAGTGACTGGTGTTTCTGACACCTCGACGAGTGAGCGCCATCCGCTACGTGGGAATGCAGCAGAGCCCCTGCAGGGAGAA[C/T]GACTACTCACCGGAGCCCTGAAAGATGGTGAGATTTACACTGCACAGTACAAATGAGAATTTCACTATTGACCCCTTAATGCTTTTTTCAGTCCTTTGTGCATTTTAAAAATGGGTTGCGAGTTCTCAGCTGATTCAGTAAGACAACAGCCATACAACTATGCACATATGAGCTTGTTTAGCCCAGTACACAGCATTGTTTGGATTAATTTACTTTTTTTTATTCAATTCAATCACCTTATGTTTCAATTAAATACATTTTCCTAGGTTGGGCATTCCTTTGGGCCACTACTGAATAAAATATTAAAGCATGGTGAATTTTAATTGAAAGTTTCAATCCCTTTCTACAGTGGAGAATCTACAGAACTTGCTGGTGATGTGTGAGCAGGGCCCAACTCCTTTCACTAGTAAGGCAACAGATCTGGTCCTGAAGAAGCCCCATGCTGACACAGGCTTGGAGAACAATACTCACATGTTACCTGAAAGTAAGACAAGCTTTCT
Associated Phenotype:
Not determined