Busch Lab

ZMP

uqcrb

Ensembl ID:
ENSDARG00000011146
ZFIN ID:
ZDB-GENE-050522-542
Description:
cytochrome b-c1 complex subunit 7 [Source:RefSeq peptide;Acc:NP_001019613]
Human Orthologue:
UQCRB
Human Description:
ubiquinol-cytochrome c reductase binding protein [Source:HGNC Symbol;Acc:12582]
Mouse Orthologue:
Uqcrb
Mouse Description:
ubiquinol-cytochrome c reductase binding protein Gene [Source:MGI Symbol;Acc:MGI:1914780]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa23598 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23598
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005191 Essential Splice Site 7 111 None 4
ENSDART00000125168 Essential Splice Site 7 111 None 5
Genomic Location (Zv9):
Chromosome 19 (position 45561138)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44459360
GRCz11 19 44054933
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCCTGTGCGTTTCTCTCAGAGAACAAAAATGGCGGCGAGGGCACCAGG[T/A]AAAAATGTTGTTCGATTTGTATTAGCGTTATGTGAAACTGTGATTTAATA
Long Flanking Sequence:
TGTATAAAAGAGGAGATTTTGAAAGTCGACATTTGTGGATGAAGAATTTACCATTTAAAATAATAAAATTAATAAAATTGTTAATTTGTTTATCACCATTTTCAAAATAATAAATAATTTATTTTGCATTCAGTGTTATCAACATAATATTTTTAGCAGAATAATCGGAAAAACAGTCTTTCCAAAATAATTGCACACTCTGACAATCAACAAATAAGTGACATAAGGATTCCTCGCTGTTTTTACAAAATGAACATTCTTTCTCAATATCTGAAAATGTGGAAAGCAACACGTTGCATGGGTATATTTTATGTAAAATTTTAAATGAATTTCTCTTACTTTATTTGAAATGCAAAATGTGTATGGCAGCAGCCATGCTGGCTGGAAAAAGTCAACTACATCTGGCAACACTGATTGCGTAATCGCCGGACAAGACGTCACGTATCCCACAACCCTGTGCGTTTCTCTCAGAGAACAAAAATGGCGGCGAGGGCACCAGG[T/A]AAAAATGTTGTTCGATTTGTATTAGCGTTATGTGAAACTGTGATTTAATATATTTGTTTTCATCAATGTAAAGAGCTTATTTATATCTTGTCTGTCTTCTGTGTTGTTAGAACTACTGTCATTAACCGTGTCTGTCAGTTTTGTCACGCAAATCACTGATGTCCTCTGAGTGTCCCCGTCTGCTTCAATGAGTTGTTGTGTGTTTTTAGCCGTAAATGTGTTGATATCCTGTTTACATCGCTTCTAGAAACTCTTTATTTGGTATTTACATGTTACAAACTGTACATTATGTGGAAACAAATGCTCTTTGATTTGTACAGATCTCATTTAGCCGGTTGTTTGTGAGTGTTTCGTAATTACAACTTGCCAGCTTCCATCTGACAACACAGAAAGCAGAAAAATAATAATAAAGCACAGAAAACTATTGCGTTTTATTAATTTATTAATGTTTCTGCACAGTTGCTGCATCCGGCAGGTTCGTGGATGTCTTCAGGAAATGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1548
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005191 Essential Splice Site 30 111 2 4
ENSDART00000125168 Essential Splice Site 30 111 2 5
Genomic Location (Zv9):
Chromosome 19 (position 45560606)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44458828
GRCz11 19 44054401
KASP Assay ID:
554-1491.1 (used for ordering genotyping assays)
KASP Sequence:
GGATGTCTTCAGGAAATGGTACTACAATGCGTGCGGGTTCAACAAACTGG[G/A]TAAGCAATGTCATATCTGTGCCATCTGTTAATCTGGTAAACATTTTAATA
Long Flanking Sequence:
GTGAAACTGTGATTTAATATATTTGTTTTCATCAATGTAAAGAGCTTATTTATATCTTGTCTGTCTTCTGTGTTGTTAGAACTACTGTCATTAACCGTGTCTGTCAGTTTTGTCACGCAAATCACTGATGTCCTCTGAGTGTCCCCGTCTGCTTCAATGAGTTGTTGTGTGTTTTTAGCCGTAAATGTGTTGATATCCTGTTTACATCGCTTCTAGAAACTCTTTATTTGGTATTTACATGTTACAAACTGTACATTATGTGGAAACAAATGCTCTTTGATTTGTACAGATCTCATTTAGCCGGTTGTTTGTGAGTGTTTCGTAATTACAACTTGCCAGCTTCCATCTGACAACACAGAAAGCAGAAAAATAATAATAAAGCACAGAAAACTATTGCGTTTTATTAATTTATTAATGTTTCTGCACAGTTGCTGCATCCGGCAGGTTCGTGGATGTCTTCAGGAAATGGTACTACAATGCGTGCGGGTTCAACAAACTGG[G/A]TAAGCAATGTCATATCTGTGCCATCTGTTAATCTGGTAAACATTTTAATAGTTTAAAGGTTCATCACTTCTTATGTTTCATTTGTCCTAATTTTATGAATGTTTTAATTCTCTTATGTTAAACATTTGAAATTAGAATACAGTATTAAATGATATCCATACATAGGCCTGTCACAATAATCAATATAGACTCCAGTGCTTCCCACAGGCTTGAAATACACTTGCGGTGGTAGCCGAAGTGAAACAGCCTTTACCCACAGCACTACATGCGGCAAACAAAACATTGTTATTTCTAACTAATTTTATTTATTATGACACTGTTTCTTTTCAGTGGGTTAAAGCAGTGGTTCTCAAACTGTGGTAGATGTTCCACTAGTTATACGCAGGCTTCCTTCTAGTGGTACACAGAGAAATCACTGAAAAATCAAAGTATAAATAAAAAAAAAAGTCTTTTAACCCTTTGATGCGTACTGATGTGTTCAGTAAATTGATTTTAATAGG
Associated Phenotype:
Not determined