Busch Lab

ZMP

si:ch211-288d18.1

Ensembl ID:
ENSDARG00000011088
ZFIN ID:
ZDB-GENE-060503-323
Description:
Novel protein similar to vertebrate USP6 N-terminal like (USP6NL) [Source:UniProtKB/TrEMBL;Acc:Q1LYR
Human Orthologues:
AC005702.1, AC053481.1, TBC1D26, TBC1D28, TBC1D3, TBC1D3B, TBC1D3C, TBC1D3F, TBC1D3G, TBC1D3H, USP6
Human Descriptions:
TBC1 domain family, member 26 [Source:HGNC Symbol;Acc:28745]
TBC1 domain family, member 28 [Source:HGNC Symbol;Acc:26858]
TBC1 domain family, member 3 [Source:HGNC Symbol;Acc:19031]
TBC1 domain family, member 3B [Source:HGNC Symbol;Acc:27011]
TBC1 domain family, member 3C [Source:HGNC Symbol;Acc:24889]
TBC1 domain family, member 3F [Source:HGNC Symbol;Acc:18257]
TBC1 domain family, member 3G [Source:HGNC Symbol;Acc:29860]
TBC1 domain family, member 3H [Source:HGNC Symbol;Acc:30708]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A6NN51]
ubiquitin specific peptidase 6 (Tre-2 oncogene) [Source:HGNC Symbol;Acc:12629]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa34170 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5441
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098864 Essential Splice Site 64 603 3 13
ENSDART00000145482 Essential Splice Site 64 409 3 13
Genomic Location (Zv9):
Chromosome 7 (position 50482876)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48753112
GRCz11 7 49025888
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTCCCACAGTGAAGAAGAATTACCCACCCCCAGTGCACTTGAAGAGAAG[G/A]TAATGTAGACATTTTTTTAACATTTATTAATACAGGCGACATSTTTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34170
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098864 Nonsense 142 603 6 13
ENSDART00000145482 Nonsense 142 409 6 13
Genomic Location (Zv9):
Chromosome 7 (position 50487767)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48758003
GRCz11 7 49030779
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTACAGAGAATGAAAGAGCAGGCTCAGCTTTACTCTCCAGAAATCAAG[C/T]AGATTGACCTCGATATCAACAGGACCTTTCGAAACCACATCATGTTTATG
Associated Phenotype:
Not determined