Busch Lab

ZMP

camk2b1

Ensembl ID:
ENSDARG00000011065
ZFIN IDs:
ZDB-GENE-030131-9588, ZDB-GENE-070615-17, ZDB-GENE-070615-17
Description:
Novel protein similar to vertebrate calcium/calmodulin-dependent protein kinase (CaM kinase) II gamm
Human Orthologue:
CAMK2B
Human Description:
calcium/calmodulin-dependent protein kinase II beta [Source:HGNC Symbol;Acc:1461]
Mouse Orthologue:
Camk2b
Mouse Description:
calcium/calmodulin-dependent protein kinase II, beta Gene [Source:MGI Symbol;Acc:MGI:88257]

Alleles

There are 11 alleles of this gene:

Allele Name Consequence Status Availability
sa38460 Nonsense Mutation detected in F1 DNA Not yet available
sa20381 Nonsense Available for shipment Available now
sa38459 Nonsense Mutation detected in F1 DNA Not yet available
sa40398 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33574 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40397 Nonsense Mutation detected in F1 DNA Not yet available
sa18200 Essential Splice Site Available for shipment Available now
sa10362 Essential Splice Site Available for shipment Available now
sa18507 Essential Splice Site Available for shipment Available now
sa38458 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8182
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044753 Nonsense 33 351 2 14
ENSDART00000098667 Nonsense 33 590 2 21
ENSDART00000133461 Nonsense 33 618 2 22
Genomic Location (Zv9):
Chromosome 5 (position 22807229)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20520101
GRCz11 5 21023901
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTTTTTTTCCYCAGGGGAGCCTTTTCAGTGGTGCGACGATGTGTAAAGT[T/A]GAGCACAGGACAAGAATATGCCGCCAAAAYCATCAACACCAAAAAACTGT
Long Flanking Sequence:
TGGAAGGTTTTATTATTTTTTTTTTTGGCTGTTCACTTATATAAAACAAAACCAACTATAGAAAAGTATTATTTATAAAATGTGGTAAACTTGATCTTTTTTTGCCATGACATAGCCATAGAAGCTGATAAAGCTGATATTTCATTTTAGTGACATCGCCACTACTGCAAAATAATCTTGACAGCGGGATGTATGGACGTTTGCTATTTAATAAATTATTCACTGTGTTTAACATTGGTAGCCATTATCCTACTCTCTTAGCTTCTGTCTATTCCCTCCTGAAGCATAAAAACAAACACCAAACATGCTGCCAGGGTTTGAGGCAGGCTTCTCTGATGTGCGCCTTTTAATTTCCATGCAGCAGAAACTTCACTGTCAACACGTTGCGCAGCTATAGCTATGTTGTTATTGTCCTGTCAAGACCTTATTCCTAAAGTCTCAATTAATTTGTCTTTTTTTCCTCAGGGGAGCCTTTTCAGTGGTGCGACGATGTGTAAAGT[T/A]GAGCACAGGACAAGAATATGCCGCCAAAATCATCAACACCAAAAAACTGTCCGCAAGAGGTGAGTCAATTTCTAAACTAATTTATGTTAATGGAACAATTTAAATGGATTCAGTTCTTCCTTTTTGTTTTATATCATTATATAGTGTTGTTTAAATTATGGCCGGGCTGATAAACGATAGTATATCTAATCGCGATAAAATTGATGTCAATACAATGATTTTTTTCCTCAATACTGATCTAAAAGCCAATCACAGAGCAGGTGCATGTGCAACAAGGGGAATCTAAAAGTGTGTTGTTATTAAAGATGTACTAAATTTTCGGCCTTCAGTGTCAGTGTAAATTTTGTGTTTTCAGTGATTGTTGGGATAATCTTTTAAATCTGGAAGCATTAAGAATTTATATTGAAATGTATGTCGTTATCTTTCAATATAGAAAATAATTATCAAGATTGCATTTTTGCTATATCAACCAGCCCTAGTTTAAATGTTTATGTTCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38460
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044753 Nonsense 55 351 3 14
ENSDART00000098667 Nonsense 55 590 3 21
ENSDART00000133461 Nonsense 55 618 3 22
Genomic Location (Zv9):
Chromosome 5 (position 22795573)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20508445
GRCz11 5 21012245
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATGTATAAAATAAGTTTAATAAATATTTTTGTTTGATTTTCAGATCAT[C/T]AGAAGCTGGAACGAGAAGCTCGAATCTGTCGTTTGCTGAAACACCCTAAC
Long Flanking Sequence:
AAGCCTGAAGGACTCGATTAGTTTGAACAGGTGTGTTTAATTAGGGTTGGAACTAAACTGTGCAGGGCTGCGGCCCTCCAGGAACTCAGTCTGACACCTGTGATTTGGTGTTATTTCATTTTTTTTTGTCTTTTTTTTTGGTCAGTTTTGGATTTATCAACAGATTTTATTTATGCTTGTTTTGCTTATTTTTGCATTTAGATTCCATTTAATAAATTTCAGTTTATGACTATATAATTTAGACAATTTTTTTTATAAAAAAAAGTTTAAAACATAATAGTAATAAAACATTGGTGAACTTTGGTGTGTATTATTTTATAATATGCTCTACTATTTTAGATTCAGTTAGATTGTAAAAAAAAAAATTAAATTAAGCAATTTGCTCTTAAAGTGCTTATAAATTATTAATGCTGATATTTCTAATTGTGTAGATGTCGCTAGAATCTCTAAATATGTATAAAATAAGTTTAATAAATATTTTTGTTTGATTTTCAGATCAT[C/T]AGAAGCTGGAACGAGAAGCTCGAATCTGTCGTTTGCTGAAACACCCTAACATCGGTAAGCTGTTTACCTTCACCATGTAAATTTTAATGGTTTGTTCGTAGACAAGTCGATTATACTTTCAGTTCAGATGAATATTGTGTGATGTTTTTACAGCCATAATAAAACCAGATTTCATTTGTTCTTCTCTTTTTCTCTTCAGTCCGTCTGCATGACAGTATATCAGAGGAGGGCTTCCACTACCTACTCTTTGATTTGTAAGTGTCAGTGCACTTCCTGCTAGAATGTTCCTCCATTTCCTGTCATCAAATTAGCTTTGACGCGAGGAACAGCGCAGCTTAAAGTGATTCATCCCTCATGTGAAATGTGCTTTGGAAGCCTTTTATCGGCTTTCTGCTTTTCTGCACTGTAAAAGGAATAGTTCAGGCAAACATAAAATTACTGTCATCATCTGCTCATCCTCACAACACTGGATAAAGATACAAGTTACAGCTGTTTTCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20381
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044753 Nonsense 59 351 3 14
ENSDART00000098667 Nonsense 59 590 3 21
ENSDART00000133461 Nonsense 59 618 3 22
Genomic Location (Zv9):
Chromosome 5 (position 22795561)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20508433
GRCz11 5 21012233
KASP Assay ID:
2259-5657.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAGTTTAATAAATATTTTTGTTTGATTTTCAGATCATCAGAAGCTGGAA[C/T]GAGAAGCTCGAATCTGTCGTTTGCTGAAACACCCTAACATCGGTAAGCTG
Long Flanking Sequence:
CTCGATTAGTTTGAACAGGTGTGTTTAATTAGGGTTGGAACTAAACTGTGCAGGGCTGCGGCCCTCCAGGAACTCAGTCTGACACCTGTGATTTGGTGTTATTTCATTTTTTTTTGTCTTTTTTTTTGGTCAGTTTTGGATTTATCAACAGATTTTATTTATGCTTGTTTTGCTTATTTTTGCATTTAGATTCCATTTAATAAATTTCAGTTTATGACTATATAATTTAGACAATTTTTTTTATAAAAAAAAGTTTAAAACATAATAGTAATAAAACATTGGTGAACTTTGGTGTGTATTATTTTATAATATGCTCTACTATTTTAGATTCAGTTAGATTGTAAAAAAAAAAATTAAATTAAGCAATTTGCTCTTAAAGTGCTTATAAATTATTAATGCTGATATTTCTAATTGTGTAGATGTCGCTAGAATCTCTAAATATGTATAAAATAAGTTTAATAAATATTTTTGTTTGATTTTCAGATCATCAGAAGCTGGAA[C/T]GAGAAGCTCGAATCTGTCGTTTGCTGAAACACCCTAACATCGGTAAGCTGTTTACCTTCACCATGTAAATTTTAATGGTTTGTTCGTAGACAAGTCGATTATACTTTCAGTTCAGATGAATATTGTGTGATGTTTTTACAGCCATAATAAAACCAGATTTCATTTGTTCTTCTCTTTTTCTCTTCAGTCCGTCTGCATGACAGTATATCAGAGGAGGGCTTCCACTACCTACTCTTTGATTTGTAAGTGTCAGTGCACTTCCTGCTAGAATGTTCCTCCATTTCCTGTCATCAAATTAGCTTTGACGCGAGGAACAGCGCAGCTTAAAGTGATTCATCCCTCATGTGAAATGTGCTTTGGAAGCCTTTTATCGGCTTTCTGCTTTTCTGCACTGTAAAAGGAATAGTTCAGGCAAACATAAAATTACTGTCATCATCTGCTCATCCTCACAACACTGGATAAAGATACAAGTTACAGCTGTTTTCAGGTCTTCTTTAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38459
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044753 Nonsense 91 351 4 14
ENSDART00000098667 Nonsense 91 590 4 21
ENSDART00000133461 Nonsense 91 618 4 22
Genomic Location (Zv9):
Chromosome 5 (position 22795319)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20508191
GRCz11 5 21011991
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGCATGACAGTATATCAGAGGAGGGCTTCCACTACCTACTCTTTGATT[T/A]GTAAGTGTCAGTGCACTTCCTGCTAGAATGTTCCTCCATTTCCTGTCATC
Long Flanking Sequence:
ATAAAAAAAAGTTTAAAACATAATAGTAATAAAACATTGGTGAACTTTGGTGTGTATTATTTTATAATATGCTCTACTATTTTAGATTCAGTTAGATTGTAAAAAAAAAAATTAAATTAAGCAATTTGCTCTTAAAGTGCTTATAAATTATTAATGCTGATATTTCTAATTGTGTAGATGTCGCTAGAATCTCTAAATATGTATAAAATAAGTTTAATAAATATTTTTGTTTGATTTTCAGATCATCAGAAGCTGGAACGAGAAGCTCGAATCTGTCGTTTGCTGAAACACCCTAACATCGGTAAGCTGTTTACCTTCACCATGTAAATTTTAATGGTTTGTTCGTAGACAAGTCGATTATACTTTCAGTTCAGATGAATATTGTGTGATGTTTTTACAGCCATAATAAAACCAGATTTCATTTGTTCTTCTCTTTTTCTCTTCAGTCCGTCTGCATGACAGTATATCAGAGGAGGGCTTCCACTACCTACTCTTTGATT[T/A]GTAAGTGTCAGTGCACTTCCTGCTAGAATGTTCCTCCATTTCCTGTCATCAAATTAGCTTTGACGCGAGGAACAGCGCAGCTTAAAGTGATTCATCCCTCATGTGAAATGTGCTTTGGAAGCCTTTTATCGGCTTTCTGCTTTTCTGCACTGTAAAAGGAATAGTTCAGGCAAACATAAAATTACTGTCATCATCTGCTCATCCTCACAACACTGGATAAAGATACAAGTTACAGCTGTTTTCAGGTCTTCTTTAAGCTGTTCTGTGAATTTTCGGATCCATATAAATGATTGGTCATAGTAAGTGTGTGTTAGGAAAATTTGTCAAAAACTACTACTTAAATTATTAAAAATGTTTTTATTATTTTTTAATAAAAAAATTTTTAAATTAGGATGTGACCTGTTTAATTTTAATGTAATAAATTTTTAAGCTAAATTGTGTGCAGCCGATGAAAATCTTTGATCAAATTAGCTTGAATAAAAAAAAGGGTATAGAAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40398
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044753 Essential Splice Site 137 351 6 14
ENSDART00000098667 Essential Splice Site 137 590 6 21
ENSDART00000133461 Essential Splice Site 137 618 6 22
Genomic Location (Zv9):
Chromosome 5 (position 22775163)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20488035
GRCz11 5 20991835
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCGGTGCTTCACTGCCATCAAATGGGTGTGGTGCACCGAGACCTGAAGG[T/C]AAGTGACGAATGTGATGTCATCGCTGTCCTTCAAGTGTGTAAACAAGTAT
Long Flanking Sequence:
ACTATTATCTCATTTACTACTATGTTTTTTGATACAATAGGGCTCTGCTAACGATTCAGTCAAATTCTCATGTGCTCAATTGACAATTTCTCAACAAAAGAAATTAAGAACAATCATTCCTAAACTCTCAGTGGGCTTACAGCATTGCTTCCATGGACCTAATTTTTTGATGTTTTTGCTGTTTAACAATAAGTGAAATCAAGCTCAGTTTTTTTTTTTTTGTTTTTTTTTTTGTTAAAGGGGTTGCTATTTTTGTAAATTTATACTAGTATTTAGTTACATGGAGGCAAGGCTAGAGTCTAGAGAGATGCCCAGCCCCTTCCCTTTGACACTTTTACCTTCCCCAAATCCCCCTCGCCTCTTGGCCTGTGCACGTGACTGTGGCGCTGCTCAGACTAACCTGCGCCCCCTGCTGTTTGCATGCAGTCACTGCATCCAGCAGATCCTGGAGGCGGTGCTTCACTGCCATCAAATGGGTGTGGTGCACCGAGACCTGAAGG[T/C]AAGTGACGAATGTGATGTCATCGCTGTCCTTCAAGTGTGTAAACAAGTATATGTGCTCATGAAAGTTGGTTCATTTGGAAATCTGTGACTACCGCTGTGTCGATTTAACGAAGACTGACATAATAGCAGGTTTGGTTTTTTTATTATGAAAATTGCTGGAAAAATTCTTTGCATTGGAGGTCAGTCTGGATTCACACAGTGATAGTGCGCAGCAAACGCGTGTTTGTGTTGCTGTTTGTGGCCATTGCTGGTGATCAATTCACTATCATGAATGTTCAGGTAAGGTCATGCTACTGGGACTGATTAAAGAGCAACCTTCATTTTTTCAATGAGAACTAATGTCTCTTGTGCACTTTAAAGAAACATCCAAGTAGAAACTTCTGAAATAGGAATATAGGCCAAATTTAATAAAGCACGACAATGTAACTTTAATCTAGACTGCTCTTAGAGAGTCAGTGTAGACATCAGGGTCCCAGACCAGTCATCATGTCCAGGTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33574
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044753 Essential Splice Site 315 351 12 14
ENSDART00000098667 Essential Splice Site 315 590 12 21
ENSDART00000133461 Essential Splice Site 315 618 12 22
Genomic Location (Zv9):
Chromosome 5 (position 22764865)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20477737
GRCz11 5 20981537
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTACAGGGCGCCATCCTCACCACCATGCTTGTGTCACGAAACTTCTCTGG[T/G]AAGTGACTTGTGTGAGTCAGAGCTGAAATCTAACCTTTGAACTGTTTTGA
Long Flanking Sequence:
ATTCTGATTTTTTAAATTATTATTATTATTTGTTCCGTAGTTTCCATCTCCAGAATGGGACACAGTTACTCCTGAAGCCAAAAACCTCATCAATCAAATGCTGACCATCAACCCTGCCAAGAGAATTACTGCACAGGAAGCTCTCAAACACCCATGGGTCTGCGTACGTATTCTCCAGCGTGCACATAGGGACACGGAACACAAAACCAGATGAATGCAGCTCTAGATATATACTAATAACCTTTTGCGTATTAATTTGTCTGTCTTTACTATTTTTTTTTATAGCAACGCTCCACTGTGGCCTCCATGATGCACAGACAGGAGACAGTGGAATGCCTGAAGAAGTTTAACGCCAGGAGGAAACTCAAGGTGTGTTTTCATGATCACACACTCGTACTCGCTCAATTCTAATTTTACACACACATACTGTACGTAATGTTTCCTCTATATTTACAGGGCGCCATCCTCACCACCATGCTTGTGTCACGAAACTTCTCTGG[T/G]AAGTGACTTGTGTGAGTCAGAGCTGAAATCTAACCTTTGAACTGTTTTGATTGACAGCAGAGTTGACAGGATTTGTGTGTTTTCTGATTGGCCTGTTCTGTGTATGTTCCCATGGCTCTCCAGGGTATCGTCTGGTGTGTTTTTAGATCCCCACTCCATCTTAATGTGCTTTTGTTACTTGTTGTCTACTAAAGAAATGTATGTCTGTGTTCTAAACCTTTTACTCACAGTTATACATACTTGTTGGCAATATCATCCATTCTATGCAGGGTTTATACAGTATGTGTAGATAGTGTGGCCCTGAAATATGATCTTTTATTGCTTTTAAAATGTATGAATGTGATATAAATAATAATTAAATCAAATTATACCTGAAATCAGATTTTTTAAAGACTTTTTAAAACTAATTTCACTTATAAAGAGCAGTGGATGTAAAATAGAGTGTAATGTTGGTAGAAATTACAAATATTATGCACAGTTAGCCACAAGAGAACTCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40397
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044753 None None 351 None 14
ENSDART00000098667 Nonsense 413 590 16 21
ENSDART00000133461 Nonsense 428 618 17 22
Genomic Location (Zv9):
Chromosome 5 (position 22724274)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20437146
GRCz11 5 20940946
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCTGTTGTTGCTGCCCCCTCTACTCCCCAGACCCCCAGCATCCCCACA[C/T]AGAGTAAGTCCCAGATGGACCCGTACTGAGGAACCAACATATTTGTTTCA
Long Flanking Sequence:
AAATAAAATGCAAAATGTATTATATTTGATGTATAATGTATATATTATATTTAAATTATATTTAAGTATTAATCCATAAAATAAGTGTACAGCTATGTTGCAAGATTTAAGTTATGCAGCTAATTTGTCTAAAGAAAAGATGAAGAGAGGCCATTATTCTACTGTGACTCTCTCATACCTCCCACCTCAGCCCTCCTATTGACACAAGGTTGTTGAAATAATGAAAAAAACTTGTATTTTTTTGGTTGAACTGTTACTTTCCTGCCACTACATGCAAGACTGTAGTGCCTGCTTTGCTCTTCTTGCAAGCCCAGCTCAGCTCTGCTCTTGTTATTTGTGTCCTGCCCCGTCTGGGCTCAACAGCTGCCACAAAGTTCACTGATCTGCTGGGTGTGGTGCGTCGGGGCTCTGTGCCCACATCTGACGCTGAGGGGGGAACCACTACCACTCCAGCTGTTGTTGCTGCCCCCTCTACTCCCCAGACCCCCAGCATCCCCACA[C/T]AGAGTAAGTCCCAGATGGACCCGTACTGAGGAACCAACATATTTGTTTCATCCTGTTTTATGGCTGTTCATGCATTTTCTTTTTCTGTCATCTGCCTTGGGCGATTTATACTGCTCCAGTGTCACGTTTGACCGATCTAGTGAGCAGTGTGCGCAGACCCACAGTCCCGCAGACAGACAGTGAGCCATCAGCTGCCAGCAGAGCCCTTTCCCCCCCAGTATCTGTCCCATCACACCCCTCCCCTTCCCCTGCCCAAGTGTCCTCCAGCCCCCTGCCGTCAGCACATTGTGAGTATGTGGTGTCAGTGTCTGCACTGGCACTGCAGCATGACTGTTTTTAATTTGTGGGAGTGTAAAAAGGTGCCAGTGATGCTACCGGTCTAACATGCATACAGTGTGTATTTCCCCGGGTTATTTAATCTCATCGCAGTGTGCACAGACGAGTAATGTATGTCGCAAATGCATCTCTATGATACCTTTTGTATTGTGCAGGGGTTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18200
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044753 None None 351 None 14
ENSDART00000098667 Essential Splice Site 514 590 20 21
ENSDART00000133461 Essential Splice Site 542 618 20 22
ENSDART00000044753 None None 351 None 14
ENSDART00000098667 Essential Splice Site 514 590 20 21
ENSDART00000133461 Essential Splice Site 542 618 20 22
ENSDART00000044753 None None 351 None 14
ENSDART00000098667 Essential Splice Site 514 590 20 21
ENSDART00000133461 Essential Splice Site 542 618 20 22
Genomic Location (Zv9):
Chromosome 5 (position 22721049)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20433921
GRCz11 5 20937721
KASP Assay ID:
2259-5656.1 (used for ordering genotyping assays)
KASP Sequence:
GGAAACCTGGTGGAGGGGATGGACTTCCACAGATTTTACTTTGAGAACCG[T/G]GAGTGTTACTGCTTCTCACTTTTGTCCWGTTATTTGTGATGGCTRATCTG
Long Flanking Sequence:
TGCTGAAAAGGAAATGCGGTGTGTAACAGCATGTAGTGTAGGTGGATGAAATCTGTTTGGGTGAATGTTTATTTGCGTGTGTTTGCCTTGTTTAAAGGAGCAGCCCGTGTGTACTGATTAACAAAACAAAACAAATTAAAAGCAAATCTCAGAAAACTTAAATACATTTTGGCATTTAATTAGAAGATGCGTCATTTGTACAAGAGATTGCTTCTGTTAAAACTTGATTTTCTCTTACAGCACGCAAACAGGAGATCATCAAAATCACTGAACAGCTTATTGAGGCCATCAACAATGGCGACTTTGAAGCCTATGCGTGAGTTAATTGTGTTTTAAATACAAAATTATAGTTTTAGATGCAAAAAAGATATGCCCCTCAAACAATGGTTTTAATGGATTTCCAGTAAAATCTGCGACCCTGGACTCACCTGCTTTGAACCTGAGGCCTTGGGAAACCTGGTGGAGGGGATGGACTTCCACAGATTTTACTTTGAGAACCG[T/G]GAGTGTTACTGCTTCTCACTTTTGTCCTGTTATTTGTGATGGCTGATCTGAAGTGTGTGGTGTTTCCGTCGCAGTGCTCTCCAAGAACAGTAAGCCCATCCACACCACCATCCTCAACCCTCACGTGCACCTGATTGGAGAAGAGGCCGCCTGCATTGCCTACATCCGCCTCACACAGTATGTGGATGGCCAGGGCCGACCGCGCAGCAGCCAATCAGAGGAGACGAGGGTGTGGCATCGCCGGGACTCCAAATGGCAGAATGTCCATTTCCACTGTTCGGGAGCTCCTGCTGCCCCTCTGCAGTGAAGGTGCATCTTCGTATAATGTTAATAATTTTAAAAAGTTACACAAACATGCTGTATAACATATTAAATAAGCAGTTTATTTAACCACAACTAAATGTTACATTTATTTTCATCTATAATGTAAGCAGTTAGATGGTTATGAAACAAACTAAATAATGAAGCAGCAAAAAATTGTATCAAAATATGTAATGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10362
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044753 None None 351 None 14
ENSDART00000098667 Essential Splice Site 514 590 20 21
ENSDART00000133461 Essential Splice Site 542 618 20 22
ENSDART00000044753 None None 351 None 14
ENSDART00000098667 Essential Splice Site 514 590 20 21
ENSDART00000133461 Essential Splice Site 542 618 20 22
ENSDART00000044753 None None 351 None 14
ENSDART00000098667 Essential Splice Site 514 590 20 21
ENSDART00000133461 Essential Splice Site 542 618 20 22
Genomic Location (Zv9):
Chromosome 5 (position 22721049)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20433921
GRCz11 5 20937721
KASP Assay ID:
2259-5656.1 (used for ordering genotyping assays)
KASP Sequence:
GGAAACCTGGTGGAGGGGATGGACTTCCACAGATTTTACTTTGAGAACCG[T/G]GAGTGTTACTGCTTCTCACTTTTGTCCWGTTATTTGTGATGGCTRATCTG
Long Flanking Sequence:
TGCTGAAAAGGAAATGCGGTGTGTAACAGCATGTAGTGTAGGTGGATGAAATCTGTTTGGGTGAATGTTTATTTGCGTGTGTTTGCCTTGTTTAAAGGAGCAGCCCGTGTGTACTGATTAACAAAACAAAACAAATTAAAAGCAAATCTCAGAAAACTTAAATACATTTTGGCATTTAATTAGAAGATGCGTCATTTGTACAAGAGATTGCTTCTGTTAAAACTTGATTTTCTCTTACAGCACGCAAACAGGAGATCATCAAAATCACTGAACAGCTTATTGAGGCCATCAACAATGGCGACTTTGAAGCCTATGCGTGAGTTAATTGTGTTTTAAATACAAAATTATAGTTTTAGATGCAAAAAAGATATGCCCCTCAAACAATGGTTTTAATGGATTTCCAGTAAAATCTGCGACCCTGGACTCACCTGCTTTGAACCTGAGGCCTTGGGAAACCTGGTGGAGGGGATGGACTTCCACAGATTTTACTTTGAGAACCG[T/G]GAGTGTTACTGCTTCTCACTTTTGTCCTGTTATTTGTGATGGCTGATCTGAAGTGTGTGGTGTTTCCGTCGCAGTGCTCTCCAAGAACAGTAAGCCCATCCACACCACCATCCTCAACCCTCACGTGCACCTGATTGGAGAAGAGGCCGCCTGCATTGCCTACATCCGCCTCACACAGTATGTGGATGGCCAGGGCCGACCGCGCAGCAGCCAATCAGAGGAGACGAGGGTGTGGCATCGCCGGGACTCCAAATGGCAGAATGTCCATTTCCACTGTTCGGGAGCTCCTGCTGCCCCTCTGCAGTGAAGGTGCATCTTCGTATAATGTTAATAATTTTAAAAAGTTACACAAACATGCTGTATAACATATTAAATAAGCAGTTTATTTAACCACAACTAAATGTTACATTTATTTTCATCTATAATGTAAGCAGTTAGATGGTTATGAAACAAACTAAATAATGAAGCAGCAAAAAATTGTATCAAAATATGTAATGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18507
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044753 None None 351 None 14
ENSDART00000098667 Essential Splice Site 514 590 20 21
ENSDART00000133461 Essential Splice Site 542 618 20 22
ENSDART00000044753 None None 351 None 14
ENSDART00000098667 Essential Splice Site 514 590 20 21
ENSDART00000133461 Essential Splice Site 542 618 20 22
ENSDART00000044753 None None 351 None 14
ENSDART00000098667 Essential Splice Site 514 590 20 21
ENSDART00000133461 Essential Splice Site 542 618 20 22
Genomic Location (Zv9):
Chromosome 5 (position 22721049)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20433921
GRCz11 5 20937721
KASP Assay ID:
2259-5656.1 (used for ordering genotyping assays)
KASP Sequence:
GGAAACCTGGTGGAGGGGATGGACTTCCACAGATTTTACTTTGAGAACCG[T/G]GAGTGTTACTGCTTCTCACTTTTGTCCWGTTATTTGTGATGGCTRATCTG
Long Flanking Sequence:
TGCTGAAAAGGAAATGCGGTGTGTAACAGCATGTAGTGTAGGTGGATGAAATCTGTTTGGGTGAATGTTTATTTGCGTGTGTTTGCCTTGTTTAAAGGAGCAGCCCGTGTGTACTGATTAACAAAACAAAACAAATTAAAAGCAAATCTCAGAAAACTTAAATACATTTTGGCATTTAATTAGAAGATGCGTCATTTGTACAAGAGATTGCTTCTGTTAAAACTTGATTTTCTCTTACAGCACGCAAACAGGAGATCATCAAAATCACTGAACAGCTTATTGAGGCCATCAACAATGGCGACTTTGAAGCCTATGCGTGAGTTAATTGTGTTTTAAATACAAAATTATAGTTTTAGATGCAAAAAAGATATGCCCCTCAAACAATGGTTTTAATGGATTTCCAGTAAAATCTGCGACCCTGGACTCACCTGCTTTGAACCTGAGGCCTTGGGAAACCTGGTGGAGGGGATGGACTTCCACAGATTTTACTTTGAGAACCG[T/G]GAGTGTTACTGCTTCTCACTTTTGTCCTGTTATTTGTGATGGCTGATCTGAAGTGTGTGGTGTTTCCGTCGCAGTGCTCTCCAAGAACAGTAAGCCCATCCACACCACCATCCTCAACCCTCACGTGCACCTGATTGGAGAAGAGGCCGCCTGCATTGCCTACATCCGCCTCACACAGTATGTGGATGGCCAGGGCCGACCGCGCAGCAGCCAATCAGAGGAGACGAGGGTGTGGCATCGCCGGGACTCCAAATGGCAGAATGTCCATTTCCACTGTTCGGGAGCTCCTGCTGCCCCTCTGCAGTGAAGGTGCATCTTCGTATAATGTTAATAATTTTAAAAAGTTACACAAACATGCTGTATAACATATTAAATAAGCAGTTTATTTAACCACAACTAAATGTTACATTTATTTTCATCTATAATGTAAGCAGTTAGATGGTTATGAAACAAACTAAATAATGAAGCAGCAAAAAATTGTATCAAAATATGTAATGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38458
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044753 None None 351 None 14
ENSDART00000098667 Nonsense 548 590 21 21
ENSDART00000133461 Nonsense 576 618 21 22
Genomic Location (Zv9):
Chromosome 5 (position 22720873)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20433745
GRCz11 5 20937545
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCACCTGATTGGAGAAGAGGCCGCCTGCATTGCCTACATCCGCCTCACA[C/T]AGTATGTGGATGGCCAGGGCCGACCGCGCAGCAGCCAATCAGAGGAGACG
Long Flanking Sequence:
TAATTAGAAGATGCGTCATTTGTACAAGAGATTGCTTCTGTTAAAACTTGATTTTCTCTTACAGCACGCAAACAGGAGATCATCAAAATCACTGAACAGCTTATTGAGGCCATCAACAATGGCGACTTTGAAGCCTATGCGTGAGTTAATTGTGTTTTAAATACAAAATTATAGTTTTAGATGCAAAAAAGATATGCCCCTCAAACAATGGTTTTAATGGATTTCCAGTAAAATCTGCGACCCTGGACTCACCTGCTTTGAACCTGAGGCCTTGGGAAACCTGGTGGAGGGGATGGACTTCCACAGATTTTACTTTGAGAACCGTGAGTGTTACTGCTTCTCACTTTTGTCCTGTTATTTGTGATGGCTGATCTGAAGTGTGTGGTGTTTCCGTCGCAGTGCTCTCCAAGAACAGTAAGCCCATCCACACCACCATCCTCAACCCTCACGTGCACCTGATTGGAGAAGAGGCCGCCTGCATTGCCTACATCCGCCTCACA[C/T]AGTATGTGGATGGCCAGGGCCGACCGCGCAGCAGCCAATCAGAGGAGACGAGGGTGTGGCATCGCCGGGACTCCAAATGGCAGAATGTCCATTTCCACTGTTCGGGAGCTCCTGCTGCCCCTCTGCAGTGAAGGTGCATCTTCGTATAATGTTAATAATTTTAAAAAGTTACACAAACATGCTGTATAACATATTAAATAAGCAGTTTATTTAACCACAACTAAATGTTACATTTATTTTCATCTATAATGTAAGCAGTTAGATGGTTATGAAACAAACTAAATAATGAAGCAGCAAAAAATTGTATCAAAATATGTAATGCTGCATTTCAAACTTGCACAATCCTGACACTTTATTAATATTCATAAGCATTTCTTAATCTTTATTTTATATTTCCTACTTACCTTATACTATAATACACATTTCAGAAAATCTGTTGTAGATAAGTAAATAGCGCACCAAAACCACCAGGCATATCCCTGTCAAGTAATTGTCTTTAT
Associated Phenotype:
Not determined