Busch Lab

ZMP

si:ch211-8a9.3

Ensembl ID:
ENSDARG00000011042
ZFIN ID:
ZDB-GENE-040724-229
Description:
piggyBac transposable element-derived protein 5 [Source:RefSeq peptide;Acc:NP_001139077]
Human Orthologue:
PGBD5
Human Description:
piggyBac transposable element derived 5 [Source:HGNC Symbol;Acc:19405]
Mouse Orthologue:
Pgbd5
Mouse Description:
piggyBac transposable element derived 5 Gene [Source:MGI Symbol;Acc:MGI:2429955]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa42197 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa35479 Nonsense Mutation detected in F1 DNA Not yet available
sa9658 Nonsense Available for shipment Available now
sa14201 Essential Splice Site Available for shipment Available now
sa6298 Nonsense Mutation detected in F1 DNA Not yet available
sa42198 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42197
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028285 Essential Splice Site 103 518 1 7
Genomic Location (Zv9):
Chromosome 13 (position 24247277)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23892937
GRCz11 13 24023387
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGCGATACGCTGCGGGACCTCAGCCTGCCTCACTACCAGGACACGCACG[G/A]TAAGTTGGTGTAACGGTGATGAACGCTGATTAGTGTAAATGCAATGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35479
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028285 Nonsense 175 518 2 7
Genomic Location (Zv9):
Chromosome 13 (position 24258036)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23903696
GRCz11 13 24034146
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAATGAAAGCATTTCTAGGCTACGTTACATCTACTAGCGTGAACCGCTG[T/A]GAGTCGGTGTTAAGCATCTGGAGCAGTGGTTTCTTCAGTAACCGCAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9658
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028285 Nonsense 401 518 5 7
Genomic Location (Zv9):
Chromosome 13 (position 24273900)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23919560
GRCz11 13 24050010
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCCAGTCTCATGTTAAGATGAGAGGAAATATGTCCATAATCAACTGGTA[C/A]AACAAAGGCAACTTCAGGTTTCTCACTAATGCCTACTCTCCTACTAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14201
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028285 Essential Splice Site 419 518 5 7
Genomic Location (Zv9):
Chromosome 13 (position 24273954)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23919614
GRCz11 13 24050064
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAGGCAACTTCAGGTTTCTCACTAATGCCTACTCTCCTACTAAAGAAGG[T/G]AAGAAAAACAYACAAAAGACWGGYTYTACATTTCCTYTAGCTTAAATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6298
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028285 Nonsense 431 518 6 7
Genomic Location (Zv9):
Chromosome 13 (position 24277807)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23923467
GRCz11 13 24053917
KASP Assay ID:
554-4635.1 (used for ordering genotyping assays)
KASP Sequence:
TCTCCTACTGTAGGTGTGATCATTAAGAGGAAGAGTGGAGAAATCCCATG[T/A]CCCCTTGCTGTGGAGGCCTTCGCTGCACACCTGAGTTACATCTGCAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42198
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028285 Nonsense 452 518 6 7
Genomic Location (Zv9):
Chromosome 13 (position 24277870)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23923530
GRCz11 13 24053980
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGCCTTCGCTGCACACCTGAGTTACATCTGCAAATATGATGACAAGTA[C/A]AGCAAGTGAGTTTGACCAGGAATCAAAGCAAGAGTTCAGTCCCCTAAAAA
Associated Phenotype:
Not determined