Busch Lab

ZMP

sh3glb1

Ensembl ID:
ENSDARG00000010956
ZFIN ID:
ZDB-GENE-030131-6851
Description:
SH3-domain GRB2-like endophilin B1 [Source:UniProtKB/TrEMBL;Acc:B0V151]
Human Orthologue:
SH3GLB1
Human Description:
SH3-domain GRB2-like endophilin B1 [Source:HGNC Symbol;Acc:10833]
Mouse Orthologue:
Sh3glb1
Mouse Description:
SH3-domain GRB2-like B1 (endophilin) Gene [Source:MGI Symbol;Acc:MGI:1859730]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa39794 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa31267 Nonsense Available for shipment Available now
sa39795 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39794
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045933 Essential Splice Site 156 360 None 9

The following transcripts of ENSDARG00000010956 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 16001950)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16512777
GRCz11 2 16181367
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTCACTCCTTTTAGGAACTTCATTGAGGGAGATTTTAAAACCATATTGG[T/C]GAGCATGCATTTTAATTCATTATATTATATTATATTATATTATATTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31267
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045933 Nonsense 248 360 7 9

The following transcripts of ENSDARG00000010956 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 16012040)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16522867
GRCz11 2 16191457
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGCTGCGTATTACGCCCAGTGTTACCAGTATACAGTCAATCTGCAGAAA[C/T]AGCTGGGCAGGTTGGCACCCTCATATCTTTATGCATTTTGTTGTGATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39795
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045933 Essential Splice Site 251 360 7 9

The following transcripts of ENSDARG00000010956 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 16012051)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16522878
GRCz11 2 16191468
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACGCCCAGTGTTACCAGTATACAGTCAATCTGCAGAAACAGCTGGGCAG[G/A]TTGGCACCCTCATATCTTTATGCATTTTGTTGTGATATCAATGTTTTTTC
Associated Phenotype:
Not determined