Busch Lab

ZMP

cbsb

Ensembl ID:
ENSDARG00000010946
ZFIN ID:
ZDB-GENE-021030-3
Description:
cystathionine-beta-synthase b [Source:RefSeq peptide;Acc:NP_001014367]
Human Orthologue:
CBS
Human Description:
cystathionine-beta-synthase [Source:HGNC Symbol;Acc:1550]
Mouse Orthologue:
Cbs
Mouse Description:
cystathionine beta-synthase Gene [Source:MGI Symbol;Acc:MGI:88285]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa27348 Nonsense Mutation detected in F1 DNA Not yet available
sa38725 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa27348
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026275 Nonsense 116 597 3 16
ENSDART00000121665 Nonsense 116 597 3 15
Genomic Location (Zv9):
Chromosome 9 (position 9443335)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 9243886
GRCz11 9 9221923
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGCTTTTTCTCACAGGACAAAGACGTCCGGTATCCTCCCCAACATCT[T/A]AAGCAAGATTGGAGAGACCCCAATGGTTCGCATGAACAAGATTCCCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38725
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026275 Essential Splice Site 312 597 8 16
ENSDART00000121665 Essential Splice Site 312 597 8 15
Genomic Location (Zv9):
Chromosome 9 (position 9427637)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 9228188
GRCz11 9 9206225
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTTGCTTTGCATTATTAATGAGATTTTTAATTTCTTTTTTTATTCTTC[A/C]GATCATTGGAGTGGATCCGGAGGGCTCTATTCTAGCTGAGCCAGACGAGT
Associated Phenotype:
Not determined