Busch Lab

ZMP

si:ch211-5k11.11

Ensembl ID:
ENSDARG00000010918
ZFIN ID:
ZDB-GENE-030131-1348
Description:
alpha globin regulatory element containing-like [Source:RefSeq peptide;Acc:NP_001020705]
Human Orthologue:
NPRL3
Human Description:
nitrogen permease regulator-like 3 (S. cerevisiae) [Source:HGNC Symbol;Acc:14124]
Mouse Orthologue:
Nprl3
Mouse Description:
nitrogen permease regulator-like 3 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:109258]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6921 Nonsense Mutation detected in F1 DNA Not yet available
sa20152 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26157
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038575 None None 581 None 13
ENSDART00000126332 Nonsense 108 619 4 15
ENSDART00000144457 None None 61 None 5
Genomic Location (Zv9):
Chromosome 3 (position 55926221)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54819947
GRCz11 3 55074549
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTTATGGCCCATTCCCATTTCAGAGAACAAAGTCCACTAACTGATGAA[C/T]AGTTGGTATCAGGGTAAGATTAAACCCCCATTTTAAACCACCTCTTCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6921
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038575 Nonsense 112 581 3 13
ENSDART00000126332 Nonsense 150 619 5 15
ENSDART00000144457 None None 61 2 5
Genomic Location (Zv9):
Chromosome 3 (position 55922582)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54816308
GRCz11 3 55070910
KASP Assay ID:
554-4748.1 (used for ordering genotyping assays)
KASP Sequence:
TTGAACTAAAAATAGACAATGTGCGATTCGTTGGRCATCCAACYTTACTR[C/T]AGCCTCCTCWTACTATTCAGGTAAGACAAGACATAWACCATTACTTSTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20152
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038575 Nonsense 142 581 4 13
ENSDART00000126332 Nonsense 180 619 6 15
ENSDART00000144457 None None 61 3 5
Genomic Location (Zv9):
Chromosome 3 (position 55920158)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54813884
GRCz11 3 55068486
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTAAAAGAGAGCTGCCCACCATGATTCTGTTCAGTGTTGTTTTTGCAT[T/A]ACGGGTAAGAAAACAATAAATGAATGTGTCAGAAAGACCCATTAAATTGT
Associated Phenotype:
Not determined