Busch Lab

ZMP

memo1

Ensembl ID:
ENSDARG00000010823
ZFIN ID:
ZDB-GENE-030131-5571
Description:
Protein MEMO1 [Source:UniProtKB/Swiss-Prot;Acc:Q803S3]
Human Orthologue:
MEMO1
Human Description:
mediator of cell motility 1 [Source:HGNC Symbol;Acc:14014]
Mouse Orthologue:
Memo1
Mouse Description:
mediator of cell motility 1 Gene [Source:MGI Symbol;Acc:MGI:1924140]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa38957 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38957
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016793 Nonsense 20 297 1 9
ENSDART00000134434 Nonsense 20 219 1 7

The following transcripts of ENSDARG00000010823 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 35748933)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35401509
GRCz11 13 35527341
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGGATGGTGTGCAGAGAAGCGAGCCACGCCGGCAGCTGGTACACGGCCT[C/A]AGGTAGAGCCAGAGACCCGAGAGCGGCCCGGGCCTGAGGTCCGGTGTCCT
Long Flanking Sequence:
CGAGTTATCCAATCATCAAAGCGTTATCAACATATACATCATATAGGCCACGCCTCTTATAGTCATTGTCCAATGAAAATGTCGCCTTTGGTCTGTCAATCAACTCTGCCAGCCCAGTTTCTCTGACGGAACGGAAGCCTAGATGGGGCAAACCAGCCCATCCGGATAACAGAGACAAACTTGGCAGCGAGCGGCTGAACTGGTCGGATCTTTGTTCTTCACAGGCAGTCTATCAACCTCTTTATACTTAAGCGTATCGTCAGTTATATGTCTCGCGTTTATATCAAGATTATAAAAAGCACCGCTTCCCTCGACACGCAGCTTTAGCACAGCCATATAACGTTACTTTCTGAGCTAGCATATTTTCCTCAGTGTTTTTAGTTCATTCTTCCCCCCACCGACGAGGTTTTATTGGACCAAGATAGGCGGCGCGGGCACCAAGATGTCGAACCGGATGGTGTGCAGAGAAGCGAGCCACGCCGGCAGCTGGTACACGGCCT[C/A]AGGTAGAGCCAGAGACCCGAGAGCGGCCCGGGCCTGAGGTCCGGTGTCCTGCTTACTGTGTGTGAGAGTCTGGAAGTGTGTCAATACATAGTGAGCTGCCTGCTCAGACAGCAATTCTGACCGCTCCTATGATGACTAGGATGCTACCTAAGTAGAAATCTCAGTTGGGTTTCAGTCACAGCCCTTTAGATCAGCTGGGAATTATTAAATAGGTGTTGCTAAAATTGTTTAAAGACCGCAGGGTGCGTTTCATAACGTGTAGCTTTTTTTCTAAATTGACAGTCGTTTATTTTGTAATTGTGTTTTAAATGTATAACTGAATGATAGTAGCTTAATTTTGCCATAGTAACGTTATCACTTTAAAGGGATTTCACTTTGCTCAGCAATAAGTCTAAATCTGCAATCTCTAATGGGTGTTGGTCATAAAATGTCGTTTATTTTATCCCATGTGATTCTTTTATAAAGTAACTTACTTTAAATGTTGGAAACGAATTCGAATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2709
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016793 Nonsense 65 297 3 9
ENSDART00000134434 Nonsense 65 219 3 7

The following transcripts of ENSDARG00000010823 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 35743892)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35396468
GRCz11 13 35522300
KASP Assay ID:
554-3287.1 (used for ordering genotyping assays)
KASP Sequence:
GGCACGCCGGCTACACYTACTGCGGTGCGTGTGCCGCTCATGCCTACAAG[C/T]AGGTGGACCCCTCCATCACGTAAGCATTTTATTTTTTACTTTGCATTCTC
Long Flanking Sequence:
TACAAGTATAATTATTAGTCATAAAAATATGTGCACATCTCAATTGTCCTAAATCTTTTAGTTTTGACTTTTACATGGTCTTTTTTTCAAAGTGATTTTGTCAAAGTGTCCCTTAAAATATCAGTTGTAGGTTATAAAGTCAGACTAGAAATACTTCAATTGACTAAATAAAAACATTTCTACATAATATGACAGTGTATAAACTACATTTATAAGACGATAAATAATCTTCCCAGCTTTCGTGTAAAAAAAACAATCTCCATGTTTCTTATTGACAATTTTCCTCTCCTTATATTTAGGATCCCAGCTTAACGCACAACTTGAGGGCTGGTTATCTCAAGCACAATCTATAGCGGGTCCAGCCAGAGCCATAATAGCACCGTAAGTGGAATGAAACCAGAAAAACACTTTCACTTGTATTTCTGATGTCTCAAAGGACTGTATTTTGCAGGCACGCCGGCTACACTTACTGCGGTGCGTGTGCCGCTCATGCCTACAAG[C/T]AGGTGGACCCCTCCATCACGTAAGCATTTTATTTTTTACTTTGCATTCTCTTGACGTAGCTGTATTATTGAGTTTGCCATGGGGAGAGAGGGTAACCGCAGCGCTGCTCTCTCATCCATCAGTCGGAGGGTGTTCATTCTCGGCCCCTCTCACCACGTGCCGCTGTCTCGCTGTGCCCTCTCCCCCGCCGAGGTCTACAGAACGCCACTGTACGACCTGAGGATCGACCAGAAGGGTAAGGAGTCTCATTTTTAGGCCTGTCACAATAATCAATGTATTGACTTATTGCATGGACATGACCTCAATGATTTTTGGTGATGCAATATATATCACCCATACATTTTAGCACCCATTATTATATCTCTATCTCTATTGGAGGTATCAGTGTCAGAATGGTTAAAATGCACTGAAGTATTTGCTATAAATTACTTTATTATATTTTTATGTGGATGTCTGTCAACTGAAAATAGATCTGGAAGCAGATATCGCAGCCTCTGTTA
Associated Phenotype:
Not determined