Busch Lab

ZMP

acsl4l

Ensembl ID:
ENSDARG00000010752
ZFIN ID:
ZDB-GENE-030131-6493
Description:
acyl-CoA synthetase long-chain family member 4, like [Source:RefSeq peptide;Acc:NP_001093209]
Human Orthologue:
ACSL4
Human Description:
acyl-CoA synthetase long-chain family member 4 [Source:HGNC Symbol;Acc:3571]
Mouse Orthologue:
Acsl4
Mouse Description:
acyl-CoA synthetase long-chain family member 4 Gene [Source:MGI Symbol;Acc:MGI:1354713]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa44604 Nonsense Mutation detected in F1 DNA Not yet available
sa31432 Essential Splice Site Available for shipment Available now
sa25296 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44604
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002453 Nonsense 69 671 2 15
Genomic Location (Zv9):
Chromosome 5 (position 25240451)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23067716
GRCz11 5 23571516
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGCACCCTGTTTGGGCACCAGAGAGGTGCTTAGCGAAGAAGAAGAAAAA[C/T]AACCCAATGGGAAGATCTTCAAAAAGGTATATTTATTGACTGACTAAGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2271
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002453 Nonsense 155 671 4 15
Genomic Location (Zv9):
Chromosome 5 (position 25236349)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23063614
GRCz11 5 23567414
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGACTYTGTATGCGACTCTGGGTGAAGATGCTGTTGCTTATGGGCTCAAT[C/T]AATGTGGCGCCACTCATCTCATCACCAGCACAGAACTGCTGCAAAGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31432
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002453 Essential Splice Site 382 671 10 15
Genomic Location (Zv9):
Chromosome 5 (position 25196722)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23023987
GRCz11 5 23527787
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTAATATCTGCTCTTCATGTTTTGTCATATTGTAATTTTGTTTGTCTCTC[A/T]GGCTGTTCTTCAAGCAGGTGAATGTGCTTCTGGGAGGCTGTGTGCGCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25296
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002453 Nonsense 431 671 10 15
Genomic Location (Zv9):
Chromosome 5 (position 25196573)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23023838
GRCz11 5 23527638
KASP Assay ID:
554-7608.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACGTGTGTTTCTGCCCCATTGCTGTGGGTTATGGCCTTACAGAGACGTG[C/A]GGAGCTGGCACTATATCAGACTGTAAGTACACACAAAAAAAAGTGTGTGA
Associated Phenotype:
Not determined