Busch Lab

ZMP

scin

Ensembl ID:
ENSDARG00000010728
ZFIN ID:
ZDB-GENE-060503-6
Description:
adseverin [Source:RefSeq peptide;Acc:NP_001038583]
Human Orthologue:
SCIN
Human Description:
scinderin [Source:HGNC Symbol;Acc:21695]
Mouse Orthologue:
Scin
Mouse Description:
scinderin Gene [Source:MGI Symbol;Acc:MGI:1306794]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36864 Nonsense Mutation detected in F1 DNA Not yet available
sa39252 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36864
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046609 Nonsense 579 733 12 16
Genomic Location (Zv9):
Chromosome 19 (position 32594621)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31761910
GRCz11 19 31349223
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGAAGAAGAGGAAAAAGCTGCAAAGTACATGAGCGAGAAGCTGAACTGC[A/T]AAACCAAAATGGTTGTTGAAGGAAAGGAGCCAGGTAAAGCTAATATGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39252
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046609 Essential Splice Site 677 733 None 16
Genomic Location (Zv9):
Chromosome 19 (position 32593247)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31760536
GRCz11 19 31347849
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAACTAATAAATATGATCATTTAACTTTCTGAATATTGTTGTACTTTTGC[A/T]GCAAAGATCTACATTGAGACAGACCCATCAGGACGGGACAAGGGGACTCC
Associated Phenotype:
Not determined