Busch Lab

ZMP

sept6

Ensembl ID:
ENSDARG00000010721
ZFIN ID:
ZDB-GENE-030131-1414
Description:
septin-6 [Source:RefSeq peptide;Acc:NP_997791]
Human Orthologue:
SEPT6
Human Description:
septin 6 [Source:HGNC Symbol;Acc:15848]
Mouse Orthologue:
Sept6
Mouse Description:
septin 6 Gene [Source:MGI Symbol;Acc:MGI:1888939]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa35719 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa35718 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35719
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018750 Essential Splice Site 49 427 2 11
ENSDART00000136442 None None 163 None 5
ENSDART00000137997 Essential Splice Site 54 432 2 11

The following transcripts of ENSDARG00000010721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 34300595)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 32985295
GRCz11 14 33325609
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCAACAAGTCCGTCAACCATGGTTTCTGCTTCAATATCCTCTGTGTGGG[T/C]GAGTGTGTCATGTGGGAGCTCCTTTTTACTTGGGGCAAAACTAAGCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35718
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018750 Nonsense 56 427 3 11
ENSDART00000136442 None None 163 None 5
ENSDART00000137997 Nonsense 61 432 3 11

The following transcripts of ENSDARG00000010721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 34294611)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 32979311
GRCz11 14 33319625
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAGATAAGCTGATGTGTTTTTGTTACAGGGGAGACGGGTTTGGGAAAGT[C/A]AACCCTCATGGACACCCTGTTTAACACCAAATTTGAGGGCGAACCTACAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4566
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018750 Nonsense 143 427 4 11
ENSDART00000136442 None None 163 None 5
ENSDART00000137997 Nonsense 148 432 4 11

The following transcripts of ENSDARG00000010721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 34291865)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 32976565
GRCz11 14 33316879
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAGCGTACCTTCAGGAGGAACTGAAGATTAAACGCACACTACACAGTTA[T/A]CATGATACACGGATCCACGCTTGCCTGTATTTCATTGCTCCCACTGGACA
Associated Phenotype:
Not determined