Busch Lab

ZMP

ARHGAP42 (2 of 2)

Ensembl ID:
ENSDARG00000010654
Description:
Rho GTPase activating protein 42 [Source:HGNC Symbol;Acc:26545]
Human Orthologue:
ARHGAP42
Human Description:
Rho GTPase activating protein 42 [Source:HGNC Symbol;Acc:26545]
Mouse Orthologue:
Arhgap42
Mouse Description:
Rho GTPase activating protein 42 Gene [Source:MGI Symbol;Acc:MGI:1918794]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa13571 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13571
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019245 Nonsense 392 863 13 24
Genomic Location (Zv9):
Chromosome 18 (position 40268868)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41878538
GRCz11 18 41879059
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCATCTATTGAACATGCTYTTTCTTGTTTCTTTGTGWAGCATATTTAAAT[G/T]AGRCTGGCTTTAATTTTGTGAGGAAGTGTATACAACTGGTGGAGGTCAGA
Long Flanking Sequence:
AATTTTCTTCAGGACATGTTAGAATCAATTATGTGCTGCTCGATAAGTAATTCACAATGATTAAAATTCAATACATTTTTGTTTCTCCTCTTAGATATACAATCTTCCTGCTATTCTAAGCAAGAAAGAAGAAAGTAAGTATTGTCTCTAACCACTACTCCAAATGCTTCATTTGTTTTTTTTTTTTAATTCTCTCTTTACTTTTTAATATATTTTAAGTGTCTTCTGTTTTGTTCAGTTAGACTGAGCTTAATGTTGAGTCTGACCTTGCGTGCTCTTATCAGTTGAACAGTTTAATCAACACTCTTTTAGATAATGTGTGGTGTTTCCCTTCACTACACCCTTTGTGTGATACTGTTCTCTCTTATTTCCTTTAACAATGTCGATACAGCATTGCATTAAGTAAAAGCAGAATAACCCCAAACCTCCTGAGTGTGGCACAATCCAAATCCATCTATTGAACATGCTTTTTCTTGTTTCTTTGTGTAGCATATTTAAAT[G/T]AGACTGGCTTTAATTTTGTGAGGAAGTGTATACAACTGGTGGAGGTCAGAGGTGAGTTGTGTGTTTACTGCAGTACTCATTGTAAATAGAGTTAGAGTTGTTTTTGTAGAAACTGAATGGCGTTACAACAAGTTGTGTTCTAATAAAAGAAATGAACCATAAAAGTAAGGAAATTAAGTTATTAGTATTATTAAGTATCCATATATGATATATATACATATGTATATATATGTATGTATGTATGTATGTATGTATTTATTTATTTGATTATTTTTATTGATTTATTTGTTTTTTTTTTTATTATCTTTCTTTTCTTTATTTATTTATTTTTATTTATTTAATTATTTATTATTGTTATTATTATTTATTATTGATTTATTTAATTATTTTACATTTTTATACATATTTGTATTTATTTATTATTATTATTTATTTTATTTATTTTTTAAATATTTTTTTCTTTATTTCTTTTATTTATTTAATTATTTTTATTTATTTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29082
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019245 Essential Splice Site 434 863 14 24
Genomic Location (Zv9):
Chromosome 18 (position 40266746)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41876416
GRCz11 18 41876937
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCGGTGGAATAAATTCAAAAGTGCAGAAGCTCATGACCACAGTCTTCTG[T/C]AAGTCTTTTTATTCTACACAGCAGCTAATGCTAGTCTCAGATACTTTCTG
Long Flanking Sequence:
ACAATCACCTGTTTGACATCACCTGTTTTAAATTACATCATTATTTAACCAGTTTGCCTGATTACTAGCCCTAAACTGCTCCTGTCTTAACTCATTTGAAATGTGTTCCAAGAACCAAAATTGAAATACCTGTTTATTTTGAAAATCAAGAGTAACATGTTAAATAATGTTTGTTTTATTGTCTGCAATGAATTACAAGTCAAAGTAAAATTAGAAATCAATTAGTTTTATTTATTTATGTATTTATTTATTTATTTATTTATTTATTTTTCTTGATTTATTTCCTTTTTTTAAGCTGAAATAATTATGGCTTTGAACACCAAATCACATGTGTTATTTTCCAATGTGTTTTCCGTGTTGTAGTTTGTGTTTTTATTTCTGTACTGTATGTTCTGTTTGTGCTCATGTATTCTCCTCTCAGCAGGGCTCAACACTATGGGTTTGTACAGAGTCGGTGGAATAAATTCAAAAGTGCAGAAGCTCATGACCACAGTCTTCTG[T/C]AAGTCTTTTTATTCTACACAGCAGCTAATGCTAGTCTCAGATACTTTCTGTCTATAAAAAAAACACCACATTTTGATTTTGGACATTTTTTTCATAGGACATAAATATTAAAACTATCCTTAGGTATACATATTTAATATTACAGTACTTCAGCATTTGTACAGAAACCATGTTGTGTGTGTTCTTTATAAAGCACCCAAAGCAGCATCAGATCTGGATTTGGACCCGGACACTTGGGACAACAAGACCATCACCAGCGGCCTCAAGAATTACCTCAGGTGTCCTTCAGTTTTTCTCTATATCACAGGCTGGTCATTTTTACTATTAATGGAGATTCAAAATGAAAACCACTATGAAAATATGCAAAGGGATAGTTCACCCAAGAAGTAAACTTTTTTTATAATTTACTCACTTGTTTAAAACCTATTTGGCTTTCTTTTTTCTGTTGAACACTAAATAAGATATTTTGAAGAATGCTACTGTAGTTGTTGGGTCTCATT
Associated Phenotype:
Not determined