Busch Lab

ZMP

slc20a1b

Ensembl ID:
ENSDARG00000010641
ZFIN ID:
ZDB-GENE-030131-260
Description:
Sodium-dependent phosphate transporter 1-B [Source:UniProtKB/Swiss-Prot;Acc:Q6PFM1]
Human Orthologue:
SLC20A1
Human Description:
solute carrier family 20 (phosphate transporter), member 1 [Source:HGNC Symbol;Acc:10946]
Mouse Orthologue:
Slc20a1
Mouse Description:
solute carrier family 20, member 1 Gene [Source:MGI Symbol;Acc:MGI:108392]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa17030 Nonsense Available for shipment Available now
sa11277 Essential Splice Site Available for shipment Available now
sa31775 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17030
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039969 Nonsense 18 665 1 10

The following transcripts of ENSDARG00000010641 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 17745164)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17757510
GRCz11 10 17714944
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GWGTCAACAACTCTTGCCACGATAACAATTATGAGCAYCCTCGTCGGGKA[T/A]ACTACAGGGCMTCTGACAGMCTATATGTGGCTCCTGATCGTAGGCTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11277
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039969 Essential Splice Site 192 665 None 10

The following transcripts of ENSDARG00000010641 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 17746448)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17758794
GRCz11 10 17716228
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
MATGTCTGCCGTCCTTTTCTACTTTGTTCGCATGTTCATCTTGCAAAAGG[T/C]AAACAGGATSTAATTTTCAGCTTATTATAAAGCATTGTAGAATTCAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31775
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039969 Essential Splice Site 586 665 9 10

The following transcripts of ENSDARG00000010641 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 17756265)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17768611
GRCz11 10 17726045
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAAACCTCCCGCATGGCAGACTTCCCTAAACAACACTTGTTTAATTTCA[G/T]CGGTTTCAGCATCGAGCTCGCCTCCGCTGTCACTGTTGTGGTGGCTTCCA
Associated Phenotype:
Not determined