Busch Lab

ZMP

sarm1

Ensembl ID:
ENSDARG00000010610
ZFIN ID:
ZDB-GENE-040219-1
Description:
sterile alpha and TIR motif-containing protein 1 [Source:RefSeq peptide;Acc:NP_001124068]
Human Orthologue:
SARM1
Human Description:
sterile alpha and TIR motif containing 1 [Source:HGNC Symbol;Acc:17074]
Mouse Orthologue:
Sarm1
Mouse Description:
sterile alpha and HEAT/Armadillo motif containing 1 Gene [Source:MGI Symbol;Acc:MGI:2136419]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa7407 Missense Mutation detected in F1 DNA Not yet available
sa10409 Nonsense Available for shipment Available now
sa19119 Nonsense Mutation detected in F1 DNA Not yet available
sa11193 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7407
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004200 Missense 319 713 2 8
Genomic Location (Zv9):
Chromosome 15 (position 27547044)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28265284
GRCz11 15 28198160
KASP Assay ID:
554-4374.1 (used for ordering genotyping assays)
KASP Sequence:
TGAGTTTGCGCGTAACATGCTGGACAGCGCAGACAGCATGCAGGGCAGAA[C/T]GGCTGCAGATCTGCAACACCTGCTGCCTCTGCTGGATGGCACAYGTCTGG
Long Flanking Sequence:
CAGGGATTATGTTGCACGTATGGGGCTCGGCGTCATCCTGAACCTGACCCGTGAGCAGGAGGATGCCCAGCTGGCACGGAGCGTGTCTGGCATCCTTGAGCACATGTTTAAACACACAGAGGAAACATCTGCACAGCTCATCACCAATGGGGCGCTGGACACCATCCTGTACTGGTGCCGTGGCACAGACCCCACCGTCCTGCGACACTGTGCTGTCGCCCTGTCAAACTGTGCCATGTACGGCGGCCACCGATGCCAGCGTCTAATGATCGAGAAGCAGGCGGCAGAATGGCTGTTTCCTCTGGCGTTCTCCAAAGAGGACGAGCTGATCCGCTTTCATGCCTGTCTGGCGGTGGCTGTGCTGGCTGCTAATAGAGAGATGGAGAAAGAAGTAGTGAAGTCTGGCACTCTGGAGCTGGTGGAGCCCTTTATTGCGTCGTTAGACCCGGATGAGTTTGCGCGTAACATGCTGGACAGCGCAGACAGCATGCAGGGCAGAA[C/T]GGCTGCAGATCTGCAACACCTGCTGCCTCTGCTGGATGGCACACGTCTGGAGGGCAAATGCATCGCTGCTTTTTACCTGTGTGTGGAGACTAGCATCAAATCACGACAACGTAATACCAAGGTCAGGCAGAAACTAGACTCTACAAGATTTCTAGGTTTTCATTTTGGTGCTATTCTTGACAGTATATATAATCTGTATAACAGTACAAGCTATTAATAATTTTAGATACAAATAAAATAAAATGTTTTTATATATATTAACAAGCATACAAATTCTAAAAATAATTTGCTTTAATTATAGATTAAGAGTACAAAGACAGAGTTAATTATATTTAAAAAACACAGTTAGGGCGACGCAGTGGCGCAGTAGGTAGTGCTGTCGCCTCACAGCAAGAAGGTTGCTGGGTCGCTGGTTCGAGCTTCGGCTCAGTTGGCGTTTCTGTGTGGAGTTTGCATGTTCTCCCTGCGTTAGCGTGGGTTTCCTCCGGGTGCTCCGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10409
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004200 Nonsense 324 713 2 8
ENSDART00000004200 Nonsense 324 713 2 8
Genomic Location (Zv9):
Chromosome 15 (position 27547030)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28265270
GRCz11 15 28198146
KASP Assay ID:
2260-8595.1 (used for ordering genotyping assays)
KASP Sequence:
ACATGCTGGACAGCGCAGACAGCATGCAGGGCAGAAYGGCTGCAGATCTG[C/T]AACACCTGCTGCCTCTGCTGGATGGCACAYGTCTGGAGGGCAAATGCATC
Long Flanking Sequence:
CACGTATGGGGCTCGGCGTCATCCTGAACCTGACCCGTGAGCAGGAGGATGCCCAGCTGGCACGGAGCGTGTCTGGCATCCTTGAGCACATGTTTAAACACACAGAGGAAACATCTGCACAGCTCATCACCAATGGGGCGCTGGACACCATCCTGTACTGGTGCCGTGGCACAGACCCCACCGTCCTGCGACACTGTGCTGTCGCCCTGTCAAACTGTGCCATGTACGGCGGCCACCGATGCCAGCGTCTAATGATCGAGAAGCAGGCGGCAGAATGGCTGTTTCCTCTGGCGTTCTCCAAAGAGGACGAGCTGATCCGCTTTCATGCCTGTCTGGCGGTGGCTGTGCTGGCTGCTAATAGAGAGATGGAGAAAGAAGTAGTGAAGTCTGGCACTCTGGAGCTGGTGGAGCCCTTTATTGCGTCGTTAGACCCGGATGAGTTTGCGCGTAACATGCTGGACAGCGCAGACAGCATGCAGGGCAGAACGGCTGCAGATCTG[C/T]AACACCTGCTGCCTCTGCTGGATGGCACACGTCTGGAGGGCAAATGCATCGCTGCTTTTTACCTGTGTGTGGAGACTAGCATCAAATCACGACAACGTAATACCAAGGTCAGGCAGAAACTAGACTCTACAAGATTTCTAGGTTTTCATTTTGGTGCTATTCTTGACAGTATATATAATCTGTATAACAGTACAAGCTATTAATAATTTTAGATACAAATAAAATAAAATGTTTTTATATATATTAACAAGCATACAAATTCTAAAAATAATTTGCTTTAATTATAGATTAAGAGTACAAAGACAGAGTTAATTATATTTAAAAAACACAGTTAGGGCGACGCAGTGGCGCAGTAGGTAGTGCTGTCGCCTCACAGCAAGAAGGTTGCTGGGTCGCTGGTTCGAGCTTCGGCTCAGTTGGCGTTTCTGTGTGGAGTTTGCATGTTCTCCCTGCGTTAGCGTGGGTTTCCTCCGGGTGCTCCGGTTTCCCCCACAGTCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19119
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004200 Nonsense 324 713 2 8
ENSDART00000004200 Nonsense 324 713 2 8
Genomic Location (Zv9):
Chromosome 15 (position 27547030)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28265270
GRCz11 15 28198146
KASP Assay ID:
2260-8595.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACATGCTGGACAGCGCAGACAGCATGCAGGGCAGAACGGCTGCAGATCTG[C/T]AACACCTGCTGCCTCTGCTGGATGGCACACGTCTGGAGGGCAAATGCATC
Long Flanking Sequence:
CACGTATGGGGCTCGGCGTCATCCTGAACCTGACCCGTGAGCAGGAGGATGCCCAGCTGGCACGGAGCGTGTCTGGCATCCTTGAGCACATGTTTAAACACACAGAGGAAACATCTGCACAGCTCATCACCAATGGGGCGCTGGACACCATCCTGTACTGGTGCCGTGGCACAGACCCCACCGTCCTGCGACACTGTGCTGTCGCCCTGTCAAACTGTGCCATGTACGGCGGCCACCGATGCCAGCGTCTAATGATCGAGAAGCAGGCGGCAGAATGGCTGTTTCCTCTGGCGTTCTCCAAAGAGGACGAGCTGATCCGCTTTCATGCCTGTCTGGCGGTGGCTGTGCTGGCTGCTAATAGAGAGATGGAGAAAGAAGTAGTGAAGTCTGGCACTCTGGAGCTGGTGGAGCCCTTTATTGCGTCGTTAGACCCGGATGAGTTTGCGCGTAACATGCTGGACAGCGCAGACAGCATGCAGGGCAGAACGGCTGCAGATCTG[C/T]AACACCTGCTGCCTCTGCTGGATGGCACACGTCTGGAGGGCAAATGCATCGCTGCTTTTTACCTGTGTGTGGAGACTAGCATCAAATCACGACAACGTAATACCAAGGTCAGGCAGAAACTAGACTCTACAAGATTTCTAGGTTTTCATTTTGGTGCTATTCTTGACAGTATATATAATCTGTATAACAGTACAAGCTATTAATAATTTTAGATACAAATAAAATAAAATGTTTTTATATATATTAACAAGCATACAAATTCTAAAAATAATTTGCTTTAATTATAGATTAAGAGTACAAAGACAGAGTTAATTATATTTAAAAAACACAGTTAGGGCGACGCAGTGGCGCAGTAGGTAGTGCTGTCGCCTCACAGCAAGAAGGTTGCTGGGTCGCTGGTTCGAGCTTCGGCTCAGTTGGCGTTTCTGTGTGGAGTTTGCATGTTCTCCCTGCGTTAGCGTGGGTTTCCTCCGGGTGCTCCGGTTTCCCCCACAGTCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11193
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004200 Nonsense 344 713 2 8
Genomic Location (Zv9):
Chromosome 15 (position 27546968)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28265208
GRCz11 15 28198084
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTCTGCTGGATGGCACAYGTCTGGAGGGCAAATGCATCGCTGCTTTTTA[C/A]YTGTGTGTRGAGACTAGCATCAAATCACGACAACGTAATACYAAGGTCAG
Long Flanking Sequence:
CGGAGCGTGTCTGGCATCCTTGAGCACATGTTTAAACACACAGAGGAAACATCTGCACAGCTCATCACCAATGGGGCGCTGGACACCATCCTGTACTGGTGCCGTGGCACAGACCCCACCGTCCTGCGACACTGTGCTGTCGCCCTGTCAAACTGTGCCATGTACGGCGGCCACCGATGCCAGCGTCTAATGATCGAGAAGCAGGCGGCAGAATGGCTGTTTCCTCTGGCGTTCTCCAAAGAGGACGAGCTGATCCGCTTTCATGCCTGTCTGGCGGTGGCTGTGCTGGCTGCTAATAGAGAGATGGAGAAAGAAGTAGTGAAGTCTGGCACTCTGGAGCTGGTGGAGCCCTTTATTGCGTCGTTAGACCCGGATGAGTTTGCGCGTAACATGCTGGACAGCGCAGACAGCATGCAGGGCAGAACGGCTGCAGATCTGCAACACCTGCTGCCTCTGCTGGATGGCACACGTCTGGAGGGCAAATGCATCGCTGCTTTTTA[C/A]CTGTGTGTGGAGACTAGCATCAAATCACGACAACGTAATACCAAGGTCAGGCAGAAACTAGACTCTACAAGATTTCTAGGTTTTCATTTTGGTGCTATTCTTGACAGTATATATAATCTGTATAACAGTACAAGCTATTAATAATTTTAGATACAAATAAAATAAAATGTTTTTATATATATTAACAAGCATACAAATTCTAAAAATAATTTGCTTTAATTATAGATTAAGAGTACAAAGACAGAGTTAATTATATTTAAAAAACACAGTTAGGGCGACGCAGTGGCGCAGTAGGTAGTGCTGTCGCCTCACAGCAAGAAGGTTGCTGGGTCGCTGGTTCGAGCTTCGGCTCAGTTGGCGTTTCTGTGTGGAGTTTGCATGTTCTCCCTGCGTTAGCGTGGGTTTCCTCCGGGTGCTCCGGTTTCCCCCACAGTCCAAAGACATGCGGTACAGGTGAATTGGGTAGGCTAAATTGTCATTAGTGTATGAGTGTTAGTGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3906
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004200 Nonsense 376 713 3 8
Genomic Location (Zv9):
Chromosome 15 (position 27544556)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28262796
GRCz11 15 28195672
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATATTTCAGGAGATTGGTGCTGTTCAGAGTCTAAAGAGGATCGTCATGTA[C/A]TCCAGTAATGCCACCGTCTGCTCTCTGGCTAAGCGGGCCTTAAAAATGAT
Long Flanking Sequence:
CCAAAACATGCAGTGCTGGTGGTTCTACAGGAACATGGTTGAGAACACTGGCCTAAACTATTGTAAAACAAGATTTTTTTTCGTAATTTTTAACATGATTAAAAATAGATAGACATTTAAGTTGCTAACTTTTTAACAACTACCAAATTAAAAATTTAAAACATTTAAATGTTGTTTTACACTAGTTAAACCCAATAAACCCACATTGTGCCCTAATGATGGTACATAATTTACATATTTACATTAATAAACCAAAGAAATAATTACCTTTTACATTAGTTATAATGTAATTATATTATAATTACATCAGTTGCATATTTATGCAGCAAATTTGATGTTTCAGAAATAATAAAGCGATTTTATTTGATTAAATTATAATTAGTAAAAAAGATTTTATTTAAATAATGCTGATATATGTTTCATGTAATATTTTCTTGGATCTTTGTTTAGATATTTCAGGAGATTGGTGCTGTTCAGAGTCTAAAGAGGATCGTCATGTA[C/A]TCCAGTAATGCCACCGTCTGCTCTCTGGCTAAGCGGGCCTTAAAAATGATGAGTGAGGAGGTCCCGAGGCGCATCCTGTCATCTGTACCCAACTGGAAGAGTGGAGAGGTGCAGACCTGGCTGCAGCAGATTGGCTTCAGTGCATTCTCTGAACGCTTTCAGGTCTGTTGAGCTCACCAAAATGAAGCTGGAAGATGTGTTGATATCATGCAGGTGTTTCCTTCAGTTTTTAAACACAGTCTTGTGCACCACATCTCTCAGGAACTGCAGGTGGATGGAGATCTGTTGCTCAATATCACGGAACAGGATCTGATCCAGGATCTGGGCATGACGTCTGGGCTCACTCGCAAGAGGCTAGTGTTTCTCAGTGGTTGGACATTCTTGCATATTTATGCAAATTTTTTTACATGTATAATCATTTAAAGCATGCAGTTCTTTAGTTAACGGTGATCTAAAATCAATAAAATAAAAAGAATAAATAATTTCACAACAATAAGCTT
Associated Phenotype:
Not determined