Busch Lab

ZMP

atp1a2a

Ensembl ID:
ENSDARG00000010472
ZFIN ID:
ZDB-GENE-001212-6
Description:
sodium/potassium-transporting ATPase subunit alpha-2 [Source:RefSeq peptide;Acc:NP_571758]
Human Orthologues:
ATP1A2, ATP1A4
Human Descriptions:
ATPase, Na+/K+ transporting, alpha 2 polypeptide [Source:HGNC Symbol;Acc:800]
ATPase, Na+/K+ transporting, alpha 4 polypeptide [Source:HGNC Symbol;Acc:14073]
Mouse Orthologues:
Atp1a2, Atp1a4
Mouse Descriptions:
ATPase, Na+/K+ transporting, alpha 2 polypeptide Gene [Source:MGI Symbol;Acc:MGI:88106]
ATPase, Na+/K+ transporting, alpha 4 polypeptide Gene [Source:MGI Symbol;Acc:MGI:1351335]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa9321 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33011 Nonsense Mutation detected in F1 DNA Not yet available
sa33010 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa39925 Nonsense Mutation detected in F1 DNA Not yet available
sa11860 Nonsense Available for shipment Available now
sa18737 Nonsense Mutation detected in F1 DNA Not yet available
sa39924 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18738
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011188 Nonsense 27 1017 2 24
ENSDART00000093298 Nonsense 27 1017 2 25
Genomic Location (Zv9):
Chromosome 2 (position 44311691)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44397192
GRCz11 2 44250190
KASP Assay ID:
2259-2554.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCGGAGGCGGCACCAACGGGGGGAAAGAGGAAGAAGAAGGATAAAGATT[T/G]AGATGAGCTGAAGAAAGAGGTGTCACTGGTAAGACGTTGTTATTTGGTCT
Long Flanking Sequence:
ATGTGCCTGCTGTGACAGTATTACTGTATTGTAACTGTCATATCATTTTCTGTACTGTTTGGCTATAATCATAATATTTAATCATGCCATGTGACATCCTGAGAATAAATGAACTCCAGACGCACATGTATTTGGTCACTATGATGAAGGCAAATTTGCAGAGTCGTGTATACTGTAGGTGCACATGCATGCTGCTTTTTAATATCCCAGCCATGTTAATACAAGCTTTAACATTTTTTTTTTTTTTGCTTAAACTGATTGTTTTTTACGATAATGTATGTCTAATTGATTAACTCTCCTCATTTCTAGTTTTAGCTACAGTATACGGAAGAATCCATGAATGAAACATAACAAGAAGTCTTATAAGTTATGAAAGATCAACCTCTGAGTAATAAAGCTGTATTCTCTGGATATTATTCTCTCCGCGTCTTAGTACGGACATGAAAGCAGCCCGGAGGCGGCACCAACGGGGGGAAAGAGGAAGAAGAAGGATAAAGATT[T/G]AGATGAGCTGAAGAAAGAGGTGTCACTGGTAAGACGTTGTTATTTGGTCTGTGTGCCTACCGAATATGTACTAATAAAAAAATAAAATAAGACTTAGCATAACTAATGATAATTAGAAATCAAACAATGAAATTGAATATGATATGTTTTAATGACTAATTGGAAAACGTGTATTATAGCTGATGTTCTTGAGTATGTTTTTTTTTTTTTTTATAGGATGATCATAAGCTGACTCTGGATGAGCTCAGTACTCGTTATGGAGTTGACCTTGCCAGAGTGAGTCATCTTTACTTTCACCCTCGACATTTGCAATAATGAATCGGATATTTTTCAAGATGGTGATGACATTTTACCCGCCGGCACATTCAAGAAGCACACCCACGGCGAACTAAAGGCTTTAGGACATTATTTAGTGATACTAGTTGGTGAAAAAGTGTTAGCTAAAATAAATATAACCTTTTGAGCCATGATATTTTTGGACTTTTTAATACAGTATTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9321
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011188 Essential Splice Site 36 1017 2 24
ENSDART00000093298 Essential Splice Site 36 1017 2 25
Genomic Location (Zv9):
Chromosome 2 (position 44311661)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44397162
GRCz11 2 44250160
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAGAAGAAGGATAAAGATTTAGATGAGCTGAAGAAAGAGGTGTCACTGG[T/A]AAGACRTTGTTATTTGGTCTGTGTGCCTACCGAAWATGTACTAATAAAAA
Long Flanking Sequence:
GTAACTGTCATATCATTTTCTGTACTGTTTGGCTATAATCATAATATTTAATCATGCCATGTGACATCCTGAGAATAAATGAACTCCAGACGCACATGTATTTGGTCACTATGATGAAGGCAAATTTGCAGAGTCGTGTATACTGTAGGTGCACATGCATGCTGCTTTTTAATATCCCAGCCATGTTAATACAAGCTTTAACATTTTTTTTTTTTTTGCTTAAACTGATTGTTTTTTACGATAATGTATGTCTAATTGATTAACTCTCCTCATTTCTAGTTTTAGCTACAGTATACGGAAGAATCCATGAATGAAACATAACAAGAAGTCTTATAAGTTATGAAAGATCAACCTCTGAGTAATAAAGCTGTATTCTCTGGATATTATTCTCTCCGCGTCTTAGTACGGACATGAAAGCAGCCCGGAGGCGGCACCAACGGGGGGAAAGAGGAAGAAGAAGGATAAAGATTTAGATGAGCTGAAGAAAGAGGTGTCACTGG[T/A]AAGACGTTGTTATTTGGTCTGTGTGCCTACCGAATATGTACTAATAAAAAAATAAAATAAGACTTAGCATAACTAATGATAATTAGAAATCAAACAATGAAATTGAATATGATATGTTTTAATGACTAATTGGAAAACGTGTATTATAGCTGATGTTCTTGAGTATGTTTTTTTTTTTTTTTATAGGATGATCATAAGCTGACTCTGGATGAGCTCAGTACTCGTTATGGAGTTGACCTTGCCAGAGTGAGTCATCTTTACTTTCACCCTCGACATTTGCAATAATGAATCGGATATTTTTCAAGATGGTGATGACATTTTACCCGCCGGCACATTCAAGAAGCACACCCACGGCGAACTAAAGGCTTTAGGACATTATTTAGTGATACTAGTTGGTGAAAAAGTGTTAGCTAAAATAAATATAACCTTTTGAGCCATGATATTTTTGGACTTTTTAATACAGTATTGCAACAGCTTGGCACTCCTAAAACAAAAATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33011
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011188 Nonsense 146 1017 5 24
ENSDART00000093298 Nonsense 146 1017 5 25
Genomic Location (Zv9):
Chromosome 2 (position 44304778)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44390279
GRCz11 2 44243277
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTTCTGTCTGCTGTGGTCATCATAACCGGCTGCTTCTCATATTATCAA[G/T]AAGCCAAAAGCTCTCGGATCATGGACTCCTTCAAAAACATGGTGCCTCAG
Long Flanking Sequence:
TTACTTGTCACAAACATGTTGGTGTTTACATGTTAAATGCAAAAGTTATTTTGCAAAAATGTTGAAAGCCTGTAACCATTGACTTCCAGAGTATTTGTTTTTCCTACAATGGAAGTCAACGGTTGTCAGTTTCTAACATTCTTCAAAACATCTACTTTTGTGTTCAAGAGAAAAACCACTTGAGGGTGAGTAAATAGTGAGTCAATTTTAATTTTGGGTAAACTTAAAGTCTATTCTTCATAAAATATTGTAGCTTTTTGGATTATATCTTTGAAGAATTAAAGAATAGATTAAACATCAAGATATCAATGGATCTTAAGAAAGATGTCTGTTTGCATGCTGTTTTAAAAAAAAATCAGTACAAAAGTACTAGTAAAGTCTTCTGTGTACTATGTTTAAACCTCTTGACCTTGTGGCTTGTCTCTGGTTGGCTGCAGTTGTATCTGGGTGTGGTTCTGTCTGCTGTGGTCATCATAACCGGCTGCTTCTCATATTATCAA[G/T]AAGCCAAAAGCTCTCGGATCATGGACTCCTTCAAAAACATGGTGCCTCAGGTCAGTGTGAGCACAGCAGTGAGTTGCCGCTGGGTAAAAGTGTGTCTGCCAAATGAATACATGAAACGAATGCCAAATCCCAAACGGAAACCATCATTATGAGCAATGTTTTATATAATTTACATAAATCCACATAAATCCCTTTTTAGCATTGGAAAGCTTGATGTATAATTCCTATAAATGCATGTAAATCCTTCCTAAGTTTTGAAAGAAACCATATTGTCAGCTCCTTTTCTCGGAATTAGCTTTACTGTATGTTGTTTTCAATACTGCCACAGTTTATACAGTAAAGACAATGTGCAACACAGTGGCTCAGTGGTTAGCAATGTCACCTCACAGCAAGAGGATTGCTGGTTCGAGTCCTGGCTGAGTCAGTTGGCATTTCTGTGAGAAGTTTGCATGTTCTCCCCGTGTTGACGTGGTTTTCCTCCAGGTGCTCCGGTTCCCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33010
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011188 Essential Splice Site 207 1017 6 24
ENSDART00000093298 Essential Splice Site 207 1017 6 25
Genomic Location (Zv9):
Chromosome 2 (position 44301943)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44387444
GRCz11 2 44240442
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGATCGAGTCCCCGCTGACCTGCGCATCATCTCCTCCAGTGGCTGCAAG[G/A]TAGACAGATATTACGTGCAGATCTGGGATCAGCTTTGCTTATTAGCTGAA
Long Flanking Sequence:
AAAAAACTTAGTATTTTACATCAATATTTATGACCTGTCTTCAATTAACACATTTTCAACTCCACCACATTCTAGAAACAATTTAATAGGTCCCCAAGCTCCCTCAAAGACATTGTATTTAACTCCTCATATATAGGTAATGTTTACTGTTGTCATGTTTGTGCACTTTACCAACTTAATGAAAACACACCTAAATCGCAAGTGGGATTTTGAAAAAATGTTTTGCTCATTTTGAAAAGATTTGCTTTATTGAAATCCTGTTATTGATAGTGCAGGGTTGCATATTACAAACTTAATACTGAGATGCTAGCTGCTATATACCTGTTCCTATATAACCTATATAAGGAACAACTTTTTTCTATCAGCAAGCTTTGGTGATCCGGGATGGGGAGAAGCTTCAGATAAATGCAGAGGAGGTGGTTCAGGGAGACCTGGTGGAGATTAAGGGTGGAGATCGAGTCCCCGCTGACCTGCGCATCATCTCCTCCAGTGGCTGCAAG[G/A]TAGACAGATATTACGTGCAGATCTGGGATCAGCTTTGCTTATTAGCTGAAAGTCTTAGCAAGATGAATGAGCTCAGAAAGAGAGCATTCTCTACCACTTGTCTGTCTTTCATAGGTTGATAACTCGTCTCTTACTGGAGAATCTGAACCTCAGACTCGATCTCCAGAGTTTACTCATGAAAACCCCCTGGAGACCCGAAACATCAGCTTCTTCTCCACCAACTGTGTGGAAGGTCTGTCATTTGTTTATTTACTGTCTGATTGATTGGTTTTATTTAGAAATGTTTATGAACATTCATTTCTTCCTGCATTTGTTCATACTTATTTTTGTCAGCATTATTCAATTTAGTCACCTGTTCATTTATTTTTTATCTCCCGTATCACTCCTTTAATGTTGCTGTTATTATGTATTTGAATCTTTATTCATTCAGCAGTGGGACATTTGATTTATTATTTTTCTTTTTATTTAAAAGTGGTATTTGTAGGAGTAGCCAAAATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39925
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011188 Nonsense 349 1017 9 24
ENSDART00000093298 Nonsense 349 1017 9 25
Genomic Location (Zv9):
Chromosome 2 (position 44295861)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44381362
GRCz11 2 44234360
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAATCTCTCTCAGGTCTGCTTGACTCTGACAGCAAAGCGTATGGCTCGC[A/T]AAAACTGCCTGGTGAAGAATCTGGAAGCTGTGGAGACTTTGGGTTCCACC
Long Flanking Sequence:
TCTCCAGAAGAATAAATATTATAGGAAACACTATAAAAAATATCATTCGGGAAATATTTAAAAAAGAAAACAAATTCACAGAAGGGCATATAATTTTGACTTCAACTGTACATGCAAACTGTCATATATCAGATATCTGGACGATGCAAAATTAAATTTTAAACAACAATCATATTTTATTATATCTTTTTAATCAAATTAATCCAGTTCACATGAGCAAATGAGACCTTTTTAAAAAAACGTACAGACCCCAAAACTTTTAAATGCTTTTATATACACCCACAGACTGAAGGTTTTGTTCACGTCCTTTCATTCTTTCCAGTCTTTTATCCTTCTCTCTTTGTCAAGACTCCGTCTTCCATTGACTTCTAAAACCCCACAAAAGCACGTTTCAAAGGCAGAAAGACCATAAAACAGCATTGCCTTTCAGCCTGTGTCCTTTAACACCAGTCAATCTCTCTCAGGTCTGCTTGACTCTGACAGCAAAGCGTATGGCTCGC[A/T]AAAACTGCCTGGTGAAGAATCTGGAAGCTGTGGAGACTTTGGGTTCCACCTCCACCATCTGCTCGGATAAAACTGGGACCCTGACTCAGAACCGGATGACCGTCGCTCACATGTGGTTTGACAACCAGATTCACGAGGCCGACACCACTGAGGATCAATCAGGTCAGCATGCTTTAAGGTCCACAGACATCTCGAGTGAACATTGCAAGGGCTATTCATGCTTCAAATTGTTTCATTCTGAAGCCTGGGCAAGCAAAATCCTGGGCTATCTAGTTTCACGGTTTACTCTGGAGGCGTTTCACATTGCCACAATGGATTTTTTTTCCCGATCTTTTTACTGACATTTTAATCAATAAAACAACTATTTCAAAAAGATTTGAAAAACAGAGAGAAATTATCTTTGCTCCAACAGAGCCCCACTGCCCTACTGCACTGCTTCTAGACAATATGCAACATAGGCTCATTCTGAAAACGTATCCCTATATACATTTCTGGAGATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25896
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011188 Essential Splice Site 852 1017 20 24
ENSDART00000093298 Essential Splice Site 852 1017 20 25
Genomic Location (Zv9):
Chromosome 2 (position 44274836)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44360337
GRCz11 2 44213335
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTACACTTGTGTTTATTTGTGCGTCTGCATTTGTGTGTGTGTGTGTCCTC[A/G]GGTATGATCCAGGCTCTGGGAGGTTTCTTCACCTATTTTGTGATAATGGC
Long Flanking Sequence:
AGGACTTGAACCAGTGACTTTCTTACTCTGAGGCCACAGTACTAACCACTGAAACCACTGTGCGTCTGTGCTTTGAGACGCACCTTATGTTTATTTATTTATTTTTTTAAATATCACATTTATAGCAGATTTTTTATTATTTATGAATTAAATAATACTCAACAAATGCAATTTCAAATTTGGTGGGACTTGTTACAGAAAATATGGTACTTATTATTTAATATTATTTACTGCAATGCGGAATAGTGTTTTCCTTTTCCTCTGCCTTTATTACAAGCAGAGTTTTGTTCCTTCTATAATCAAACAAATAAATAGCTCTTGCATTGCAGGTGTCACCGAAAAACTATTTTAGAAACCTGAAGGGGGTGAATAAGCCTCATGGTTCAGATTATCATTGAGAATAAAAGAGCTTTTCGTACTCAGCGGGTATAAGAGGAATTAAATGTGTTTGTACACTTGTGTTTATTTGTGCGTCTGCATTTGTGTGTGTGTGTGTCCTC[A/G]GGTATGATCCAGGCTCTGGGAGGTTTCTTCACCTATTTTGTGATAATGGCTGAAAATGGATTTCTGCCTCAAACGCTGCTGGGAATTCGACTGGATTGGGATGATCGTACAGTTAATGACCTGGAGGACGGCTATGGCCAGCAATGGGTAAACACATACTCTTTACACCACCATATGAATGTCAGTGGTTGTCAGATTGTATGCTTAACACCTAATTGTATAATACTGACATTTGATGTTTTTAATTTTTTTTATTCAGTTCTATTATTTACTAAACATAACTTTCTAATCGCCGTCATTTTCAAATCAATTTTTATTTATGCCTTTTTTATTAAAAAGATTCAGATCATTTTAATTGTATTAAAAGATTACCAACACTCTTTGGGCTCTATTTTGACTATCCATGTGCAAAGTGCAAATCGCAGGGCGCAAACGCATTAAGGCCATGCTCAAATCTACTTTTGCTATTTTATGGACGAAAAAATGGCGCATGACCTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11860
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011188 Nonsense 982 1017 23 24
ENSDART00000093298 Nonsense 982 1017 23 25
ENSDART00000011188 Nonsense 982 1017 23 24
ENSDART00000093298 Nonsense 982 1017 23 25
Genomic Location (Zv9):
Chromosome 2 (position 44269683)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44355184
GRCz11 2 44208182
KASP Assay ID:
2259-2551.1 (used for ordering genotyping assays)
KASP Sequence:
CTKTTCCTCACCTTTCTTCTCTTRTTTTCTTCTTGCAGGATTATGTGGTG[G/A]TTCTGTGCTTTCCCGTACAGTCTGCTTATCTTTGTGTATGATGAGATCCG
Long Flanking Sequence:
TTGCTTCCCGTTTGATGATGAATCTATATAAATATGTATGTTTCAGACGTACGAGCAGCGTAAGATCATCGAGTTCACCTGTCACACGTCGTTCTTCGTCAGCATTGTGGTGGTGCAGTGGGCCGATCTCATCATCTGCAAGACACGCAGGAACTCCGTCTTCCAGCAGGGCATGAAGTCAGTGCTGCAGCCGGGATGTTTGTGAGCATTTACTAGAGTGATATTTGCATACATCTCTGTTAAAGGCTATTCTCTGGCCTGTGCTCTTATAGGAATAGGATTCTCATTTTCGGCCTGTTTGCCGAGACGGCTCTAGCAGCCTTCCTGTCCTACTGCCCCGGTATGGACGTTGCCCTGAGGATGTACCCACTCAAGTAAGGGACAAACACATACACACACACACACACACACACACACTTCTCTATAAAAGAGCTTATTTTCTCTCCTCCTCTTTTCCTCACCTTTCTTCTCTTGTTTTCTTCTTGCAGGATTATGTGGTG[G/A]TTCTGTGCTTTCCCGTACAGTCTGCTTATCTTTGTGTATGATGAGATCCGTAAGTTTATCCTGCGGAGAAATCCAGGAGGTGAGCACAGATTACTACAAAGAACTTCTATAATATCCTACAATTATGATTTCAGAAGAGCGAATGCGCCATTTCTAGATTGTGCACTCTCTGTTTAAAGTACTGATTACTATTATAGGGGTTACTTTTTTTATTATTGGTTTACAAACTAAAAAAAAAAAAAAAAACACTTTAATTTTCTTATATTGCAGCATTAAATCCTTTCTCTGAAACTACTGGTCTCTATAAACCCCATCTCTCTGAGCGTTTACTCTGCTCTGATTGGTTAGATCATAGCCCAGTTTATTATGATTGGTCGACCACCTATGCCTCATTCACACTAGCAGTGACTTTGTATCTGCCTGTCTCTTTCGGTGTTGACCTGCAGTCAACACAGGTCTTTGTAGCAAACCTGCCAACGTTCGGTTTCTACAATCCGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18737
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011188 Nonsense 982 1017 23 24
ENSDART00000093298 Nonsense 982 1017 23 25
ENSDART00000011188 Nonsense 982 1017 23 24
ENSDART00000093298 Nonsense 982 1017 23 25
Genomic Location (Zv9):
Chromosome 2 (position 44269683)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44355184
GRCz11 2 44208182
KASP Assay ID:
2259-2551.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTTCCTCACCTTTCTTCTCTTGTTTTCTTCTTGCAGGATTATGTGGTG[G/A]TTCTGTGCTTTCCCGTACAGTCTGCTTATCTTTGTGTATGATGAGATCCG
Long Flanking Sequence:
TTGCTTCCCGTTTGATGATGAATCTATATAAATATGTATGTTTCAGACGTACGAGCAGCGTAAGATCATCGAGTTCACCTGTCACACGTCGTTCTTCGTCAGCATTGTGGTGGTGCAGTGGGCCGATCTCATCATCTGCAAGACACGCAGGAACTCCGTCTTCCAGCAGGGCATGAAGTCAGTGCTGCAGCCGGGATGTTTGTGAGCATTTACTAGAGTGATATTTGCATACATCTCTGTTAAAGGCTATTCTCTGGCCTGTGCTCTTATAGGAATAGGATTCTCATTTTCGGCCTGTTTGCCGAGACGGCTCTAGCAGCCTTCCTGTCCTACTGCCCCGGTATGGACGTTGCCCTGAGGATGTACCCACTCAAGTAAGGGACAAACACATACACACACACACACACACACACACACTTCTCTATAAAAGAGCTTATTTTCTCTCCTCCTCTTTTCCTCACCTTTCTTCTCTTGTTTTCTTCTTGCAGGATTATGTGGTG[G/A]TTCTGTGCTTTCCCGTACAGTCTGCTTATCTTTGTGTATGATGAGATCCGTAAGTTTATCCTGCGGAGAAATCCAGGAGGTGAGCACAGATTACTACAAAGAACTTCTATAATATCCTACAATTATGATTTCAGAAGAGCGAATGCGCCATTTCTAGATTGTGCACTCTCTGTTTAAAGTACTGATTACTATTATAGGGGTTACTTTTTTTATTATTGGTTTACAAACTAAAAAAAAAAAAAAAAACACTTTAATTTTCTTATATTGCAGCATTAAATCCTTTCTCTGAAACTACTGGTCTCTATAAACCCCATCTCTCTGAGCGTTTACTCTGCTCTGATTGGTTAGATCATAGCCCAGTTTATTATGATTGGTCGACCACCTATGCCTCATTCACACTAGCAGTGACTTTGTATCTGCCTGTCTCTTTCGGTGTTGACCTGCAGTCAACACAGGTCTTTGTAGCAAACCTGCCAACGTTCGGTTTCTACAATCCGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39924
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011188 Nonsense 995 1017 23 24
ENSDART00000093298 Nonsense 995 1017 23 25
Genomic Location (Zv9):
Chromosome 2 (position 44269644)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44355145
GRCz11 2 44208143
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTATGTGGTGGTTCTGTGCTTTCCCGTACAGTCTGCTTATCTTTGTGTA[T/A]GATGAGATCCGTAAGTTTATCCTGCGGAGAAATCCAGGAGGTGAGCACAG
Long Flanking Sequence:
GTTTCAGACGTACGAGCAGCGTAAGATCATCGAGTTCACCTGTCACACGTCGTTCTTCGTCAGCATTGTGGTGGTGCAGTGGGCCGATCTCATCATCTGCAAGACACGCAGGAACTCCGTCTTCCAGCAGGGCATGAAGTCAGTGCTGCAGCCGGGATGTTTGTGAGCATTTACTAGAGTGATATTTGCATACATCTCTGTTAAAGGCTATTCTCTGGCCTGTGCTCTTATAGGAATAGGATTCTCATTTTCGGCCTGTTTGCCGAGACGGCTCTAGCAGCCTTCCTGTCCTACTGCCCCGGTATGGACGTTGCCCTGAGGATGTACCCACTCAAGTAAGGGACAAACACATACACACACACACACACACACACACACTTCTCTATAAAAGAGCTTATTTTCTCTCCTCCTCTTTTCCTCACCTTTCTTCTCTTGTTTTCTTCTTGCAGGATTATGTGGTGGTTCTGTGCTTTCCCGTACAGTCTGCTTATCTTTGTGTA[T/A]GATGAGATCCGTAAGTTTATCCTGCGGAGAAATCCAGGAGGTGAGCACAGATTACTACAAAGAACTTCTATAATATCCTACAATTATGATTTCAGAAGAGCGAATGCGCCATTTCTAGATTGTGCACTCTCTGTTTAAAGTACTGATTACTATTATAGGGGTTACTTTTTTTATTATTGGTTTACAAACTAAAAAAAAAAAAAAAAACACTTTAATTTTCTTATATTGCAGCATTAAATCCTTTCTCTGAAACTACTGGTCTCTATAAACCCCATCTCTCTGAGCGTTTACTCTGCTCTGATTGGTTAGATCATAGCCCAGTTTATTATGATTGGTCGACCACCTATGCCTCATTCACACTAGCAGTGACTTTGTATCTGCCTGTCTCTTTCGGTGTTGACCTGCAGTCAACACAGGTCTTTGTAGCAAACCTGCCAACGTTCGGTTTCTACAATCCGGAATATTTTCTCCAGGGGTGTGCGCGCAAAGTGAAGAGCAGG
Associated Phenotype:
Not determined