Busch Lab

ZMP

clu

Ensembl ID:
ENSDARG00000010434
ZFIN ID:
ZDB-GENE-040426-1774
Description:
clusterin [Source:RefSeq peptide;Acc:NP_957096]
Human Orthologue:
CLU
Human Description:
clusterin [Source:HGNC Symbol;Acc:2095]
Mouse Orthologue:
Clu
Mouse Description:
clusterin Gene [Source:MGI Symbol;Acc:MGI:88423]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29427
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101138 Nonsense 71 449 2 8
ENSDART00000126333 Nonsense 71 445 3 8
ENSDART00000127173 Nonsense 71 449 3 9
ENSDART00000141193 None None 121 None 3
Genomic Location (Zv9):
Chromosome 20 (position 39296226)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39368638
GRCz11 20 39271517
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAGACTGTGATGGAGCGATCCGAAGAGGAGCACAAGAGGATGCTGTCG[G/T]AGATGGAGAAAACCCAAAAAGAGAAAGAGGTGAAATATAGAGCTTATATT
Associated Phenotype:
Not determined